Labshake search
Citations for Promega :
2451 - 2500 of 5310 citations for 6 methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 µg retroviral vectors were independently introduced into Plat-GP cells using 2.25 µL of FuGENE 6 transfection reagent (Promega, Madison, WI, United States). In addition ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK-293 cells cultured in DME/F-12 with 10% fetal bovine serum were transfected with either of these constructs using FuGENE 6 Transfection Reagent (#E2691) from Promega (Madison, WI, USA). Approximately 72 hours after transfection ...
-
bioRxiv - Immunology 2021Quote: ... Pseudovirions were produced in HEK 293T/17 cells (ATCC cat. no. CRL-11268, Manassas, VA, USA) by transfection using Fugene 6 (catalog number E2692, Promega, Madison, WI, USA) and a combination of spike plasmid ...
-
bioRxiv - Neuroscience 2020Quote: ... COS-7 cells were transiently transfected with 2μg plasmid (MuSK-HA, or GFP-Vangl2 alone, or in combination) using Fugene® 6 reagent (Promega, catalog no. E2311), according to the manufacturer’s recommendations ...
-
bioRxiv - Physiology 2023Quote: Glutathione content was measured under normoxic conditions and after exposure to 30 min and 6 h hypoxia using the GSH-Glo Assay Kit (Promega, Madison, WI, USA) according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Cancer Biology 2024Quote: ... Apoptotic cell count was measured as described above using the Caspase-Glo® 3/7 3D Assay (Promega). Bliss synergy scores were calculated using the SynergyFinder web application (version 3.0)61.
-
bioRxiv - Neuroscience 2024Quote: ... the wild type and mutated Nnat 3’UTR was inserted into a pmirGLO dual-luciferase expression vector (Promega). Detailed description of the design of these constructs and of the rescue constructs are listed in the supplementary material section ...
-
bioRxiv - Cancer Biology 2024Quote: ... Spheroids were treated as indicated for 3 days and viability was measured using 3D CellTiter-Glo (#G9682, Promega) and a GloMax luminometer (Promega).
-
bioRxiv - Genomics 2019Quote: ... the gel slices were then hydrated with 5 ng/uL sequencing grade trypsin (Promega) in 50 mM ammonium bicarbonate and digested overnight at 37°C on an orbital shaker ...
-
bioRxiv - Genomics 2019Quote: ... 1989.) 5-mC free Lambda genomic DNA was purchased from Promega (Madison, WI, USA).
-
bioRxiv - Developmental Biology 2021Quote: ... embryos were co-injected with 5 pg of pRL-TK:renilla luciferase plasmid (Promega E2241) + 50 pg of the pGL4.23 luc2/miniP enhancer:luciferase plasmid and the following amounts of MOs or mRNAs into each dorsal marginal zone (dmz ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were subjected to a pulse with 5 µM biotin-HaloTag ligand (G828A, Promega) diluted in complete medium for 3 hours ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL GoTaq® Probe qPCR Master Mix with dUTP (2X) (Promega, Madison, WI), 0.2 μL GoScript™ RT Mix for 1-Step RT-qPCR (Promega ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... alongside 5 µl of broad molecular weight protein marker (Broad Range Molecular Marker, Promega), was loaded onto the gel and run at 200 volts for 55 minutes using a Mini-PROTEAN Electrophoresis System (Bio-Rad ...
-
bioRxiv - Plant Biology 2022Quote: ... Cells were collected and lysate in BugBuster (EMDMillipore) with 5 ul RQ1 DNase (Promega). The supernatant was flowed through a column packed with Ni-NTA (QIAGEN) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were allowed to grow for 5 days before adding an MTS reagent (Promega) and measuring absorbance at 492 nM on a BioTek Synergy H1 microplate reader (BioTek Instruments ...
-
bioRxiv - Genetics 2020Quote: Full-length wild-type and mutant Csde1 5’UTRs were inserted pGL3 (Promega, E1751) plasmid in between EcoRI and NcoI sites upstream of Firefly luciferase gene ...
-
bioRxiv - Immunology 2022Quote: ... followed by the addition of 5 μL RQ1 RNase-Free DNase (Promega, Cat# M6101) and incubation at 37°C for 15 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2ul/5-10mg DW of Trypsin/Lys-C (Endoproteinase LysC) Mix (Promega, Cat #V5071) was added to samples and incubated with continuous agitation at 150 rpm for overnight at 37°C ...
-
bioRxiv - Plant Biology 2022Quote: ... Proteins eluted at pH 9.0 were further treated with 5 U of CIAP (Promega) and the buffer provided by the manufacturer (a negative control was prepared without phosphatase) ...
-
bioRxiv - Molecular Biology 2022Quote: ... proteins were digested with chymotrypsin (5 ng/μL) at 25ºC overnight (Trypsin gold, Promega). Digestion was stopped by addition of 5% formic acid and peptides extracted twice with 70% acetonitrile and 5% formic acid (10 min sonication) ...
-
bioRxiv - Genomics 2024Quote: ... Trypsin digestion was done by adding 5 µL reductively methylated trypsin (Promega, Madison, USA) to each sample and incubating the samples overnight at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were incubated at 25°C for 5 days before CellTiter-Glo assays (Promega) were performed ...
-
bioRxiv - Immunology 2023Quote: ... Luciferase Assay System (E1501) and Passive Lysis 5 × Buffer (E1941) were purchased from Promega. C1q recombinant protein (A400 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μm tissue scrolls were processed using the Maxwell RSC RNA FFPE instrument (Promega). RNA concentration and quality was determined using a TapeStation automated electrophoresis instrument (Agilent) ...
-
bioRxiv - Neuroscience 2023Quote: ... transferred to opaque 96-well plates containing 5 μM furimazine (NanoLuc Luciferase Assay, Promega), and bathed in 5-HT at various concentrations (ranging from 0.1 nM to 1 mM) ...
-
bioRxiv - Cell Biology 2024Quote: ... the 5′-end of each mRNA was capped using Ribo m7G Cap Analog (Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated with 5-100 pM of JF549-HTL (Cat. No. GA1110, Promega) and 50 nM Hoechst 33342 for an hour in complete medium ...
-
bioRxiv - Neuroscience 2022Quote: RNA was extracted from sections of frozen mouse brain cerebrum representing each treatment group (n = 6 per group) using the Maxwell 16 LEV simplyRNA Tissue Kit (Promega, Ipswich, MA, USA; AS1270). RNA was extracted from cultured cells using the Maxwell 16 Cell LEV Total RNA Purification Kit (Promega ...
-
bioRxiv - Microbiology 2020Quote: Viral RNA was extracted from the OP and CL swab samples collected from chickens and tufted ducks using Maxwell® 16 Viral Total Nucleic Acid Purification Kit on a Maxwell® 16 System extraction robot (Promega, Madison, WI, USA). RNA was isolated from lung ...
-
bioRxiv - Biochemistry 2024Quote: Kinase assay for GSK-3α and GSK-3β to assess the inhibitory potency of Psoralidin and Rosmarinic acid was performed employing GSK-3α and GSK-3β enzyme system (Promega Cat# V9361 and V9371, respectively) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... and cells were lysed at 4 hours post-transfection with 250 μL passive lysis buffer (Promega) and incubated 20 minutes at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... and cells were lysed at 4 hours post-transfection with 250 μL passive lysis buffer (Promega) and incubated 20 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... and NUMB1-4 (from V.O.R.) expression plasmids was performed using FuGENE HD transfection reagent (Promega, E2311) according to the manufacturer’s protocol and selected with Geneticin (Gibco ...
-
bioRxiv - Cancer Biology 2022Quote: ... Viability was measured every 4 days using the CellTiter-Glo luminescent cell viability assay (Promega G7573). A D300e drug dispenser (Tecan ...
-
bioRxiv - Plant Biology 2022Quote: ... and GST- GBF3 were purified from 4 ml culture and immobilized on MagneGST Glutathione particles (Promega). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... then digested with 4 μL of a trypsin/Lys-C Mix (0.5 μg/uL) (Promega # V5071) using a two-step in-solution digestion overnight at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... HRP (4 μM) was added followed by 20 μL of Nano-glo luciferase substrate (Promega, N1110) to each well ...