Labshake search
Citations for Promega :
201 - 250 of 1075 citations for Potassium 3 4 difluorophenyl trifluoroborate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Caspase3/7 activity was measured 3 days after the treatment with a commercial available kit (Caspase-Glo 3/7 Assay, Promega).
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Cell Biology 2022Quote: ... Caspase 3/7 activity was assayed according to the manufacturer’s protocol for ApoOne® Homogenous Caspase 3/7 Assay (Promega). Fluorescence was measured with Glomax Multi plate reader (Promega).
-
bioRxiv - Cancer Biology 2022Quote: ... Treatments were removed 48 or 72 h later and enzymatic activities of caspase-3 and -7 were measured using Caspase-Glo 3/7 Assay (Promega) and read by a microplate reader (SpectraMax M5).
-
bioRxiv - Cancer Biology 2022Quote: Caspase 3/7 activity was measured using a luminescence Caspase Glo 3/7 assay kit (G8090; Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... The V4 region of the 16S rRNA gene was amplified using the universal primers 515F (5′-GTG CCA GCM GCC GCG GTA A-3′) and 806R (5′-GGA CTA CNN GGG TAT CTA AT-3′) [26] with Taq&Load MasterMix (Promega). PCR reactions ...
-
bioRxiv - Pathology 2021Quote: ... induction of apoptosis was determined by measurement of caspase-3/7 activity using the luminometric Caspase-Glo 3/7 assay (Promega) according to the manufacturer’s protocol and a microplate reader (Microplate Reader SH900) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were seeded on 24 mm glass coverslips and transfected with 2 µg plasmid DNA (1:1.3:3 ratio LAMP1:ER:opto-kinesin) and Fugene6 transfection reagent (Promega 1:3) for 20-30 h prior to imaging ...
-
bioRxiv - Genomics 2022Quote: ... Caspase 3/7 activity was measured 16 and 24 h later using the Caspase-Glo 3/7 Assay System (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... a total of 18 RNA extractions (3 morphs × 3 tissues × 2 biological replicates) were performed using the SV Total RNA Isolation System (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: ... and digested with 3 μg LysC (Wako) O/N at 37°C and then with 3 μg of trypsin (Promega) for eight hours at 37°C following FASP procedure (Filter-aided sample preparation 48) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The activity of caspase 3/7 was measured after 48 h using the Caspase-Glo® 3/7 assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Initial P0 virus was obtained by addition of ∼3 µg recombinant bacmid DNA mixed with 3 µl FuGENE HD Transfection reagent (Promega) in 100 µl Sf900 II media (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... caspase-3/7 activities in cells were measured using a luminometric assay kit Caspase-Glo 3/7 (Promega, Madison, WI). The amount of luminescence was measured on the Victor3™ multilabel reader (PerkinElmer Inc.).
-
bioRxiv - Microbiology 2023Quote: ... Caspase 3/7 enzymatic activity in raw cell lysates was measured using a Caspase Glo 3/7 assay kit (Promega) according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... Apoptosis was measured by detecting Caspase 3/7 activity after 24 hours of treatment using the Caspase-Glo 3/7 Assay System (Promega) on a BMG CLARIOstar plate reader ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Physiology 2024Quote: ... The locus containing the rdu14 allele was amplified by PCR, using the following primers (Forward: 5’-TGATTCACACTACTTACTTGTCTAG-3’, Reverse: 5’-GATTAAAAGTAGTTATCTCATCCTCAG-3’) and GoTaq polymerase (Promega, ). The genotype of the locus was scored after resolving samples on 2.5% agarose gels as HNF4α+/+ ...
-
bioRxiv - Neuroscience 2024Quote: Ensembl predicted regulatory region including the POU domain binding site on Aspm promoter/enhance (sequence from 5’-GAAAAAGTGGGCAGTAACTCGC-3’ to 5’-CAACCTTTCCCTGAGGACGATC-3’) was synthesized by Twist Bioscience and cloned into pGL3-Basic Luciferase Reporter vector (Promega) using the Gibson assembly method ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 assay reagents (Promega, WI, USA) were added to each well according to the manufacturer’s instructions (ratio of 1:4) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3’-UTR derived from pNL1.1[Nluc] vector (Promega), and 50 nt poly(A ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Bioengineering 2021Quote: ... Caspase-Glo® 3/7 Assay System (Promega) was used according to manufacturer’s guidelines ...
-
bioRxiv - Systems Biology 2020Quote: ... and T4 DNA ligase (3 U/μί, Promega) were applied to assemble all of the synthetic promoter blocks sequentially and simultaneously into the firefly reporter vector backbone in a one-pot reaction ...
-
bioRxiv - Cancer Biology 2020Quote: Caspase 3/7 Assay kit (Promega, Southampton, UK) was utilized to assess apoptosis as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Caspase-Glo 3/7 assay (Promega, Madison, WI) (5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Caspase-Glo 3/7 Assay (Promega, Cat# G8090) reagent was added to the cells and incubated for 30 min ...
-
bioRxiv - Bioengineering 2022Quote: ... by Caspase-Glo® 3/7 Assay (Promega) using GloMax Discover Microplate Reader (Promega).
-
bioRxiv - Biochemistry 2021Quote: ... 1.8 nM 3 kb supercoiled pGEMT plasmid (Promega), and 20 nM MMTV intasomes in a final volume of 15 µL ...
-
bioRxiv - Cancer Biology 2022Quote: ... or Caspase-Glo® 3/7 (Promega, USA) respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... Caspase-Glo 3/7 3D Assay (Promega, #G8981) was added and the mixture incubated per manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... The caspase 3/7 (Caspase-GloTM Promega G8090) level was measured per the manufacturer’s instructions.
-
bioRxiv - Zoology 2023Quote: ... and 3% 20 mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact ...
-
bioRxiv - Cell Biology 2023Quote: Caspase-Glo 3/7 Assay (Promega, Fitchburg, WI) and ROS-Glo H2O2 Assay (Promega ...
-
bioRxiv - Zoology 2024Quote: ... and 3% 20 mg/ml Proteinase K (Promega). This method removed cellular material while preserving spicules and the spongin network (if present) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The endpoints of the second screen were caspase 3/7 activity measured using the CaspaseGlo® 3/7 assay reagent (Promega) at the 8-hour and 16-hour time intervals ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... Apoptosis was determined as Caspase-3/7 activity immediately after 6-day culture using Caspase-Glo 3/7 Assay (Promega, USA). Luminescence was recorded with the Infinite M200 PRO microplate reader (Tecan ...
-
bioRxiv - Cancer Biology 2024Quote: ZEB1 3′UTR region with mitomiR-3 binding site was cloned into pmirGLO-Dual Luciferase miRNA target expression vector (Promega, USA) for miRNA luciferase reporter assay (Promega ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 ng of Renilla (pRL-CMV, Promega), and 0.12 μL of X-tremeGENE HP ...