Labshake search
Citations for Promega :
201 - 250 of 3742 citations for Human Immunodeficiency Virus GP120 Protein HIV 1 Clade A KNH1144 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... and 0.5 μg of reference plasmid pRL-TK carrying the Renilla luciferase gene under the control of the simian virus 40 enhancer and promoter (Promega). Lipofectamine 3000 reagent (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... We estimated the number of infectious virus after two days by quantifying the luminescence in each well using Bright Glo Luciferase Assay System (Promega). Differences in relative luciferase units (RLUs ...
-
bioRxiv - Microbiology 2022Quote: ... Complementary DNA was synthetized from 500 ng total RNA by using random hexamers and moloney murine leukemia virus (M-MLV) reverse transcriptase (RT) Point Mutant Synthesis System (Promega). Quantification was performed by using the LightCycler 480 Universal Probe Library System (Roche) ...
-
bioRxiv - Microbiology 2023Quote: Cells infected with a luciferase-encoding virus were lysed 2 days after infection with a Bright-Glo Luciferase Assay System (E2620, Promega) and the luminescent signal was measured using a GloMax Explorer Multimode Microplate Reader (Promega).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Initial P0 virus was obtained by addition of ∼3 µg recombinant bacmid DNA mixed with 3 µl FuGENE HD Transfection reagent (Promega) in 100 µl Sf900 II media (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1ug of each RNA sample was reverse-transcribed using Moloney Murine Leukemia Virus reverse transcriptase (M-MLV-RT, Promega, #M1701) and random hexamer primers (Thermo Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein expression was confirmed by Western blot with Anti-HaloTag monoclonal Ab (1:2000) (Promega). Cy3-labeled and unlabeled dsDNA probes were generated with oligonucleotides listed in Supplemental Table 5 ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins in each well were digested with 1 μg of sequencing-grade trypsin (Promega Inc.) in 75 μl of 50 mM ammonium bicarbonate and incubated overnight ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... On-bead protein digestion was performed by adding 1 µg of sequencing grade trypsin (Promega) to the samples ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were digested on-bead either with sequencing-grade trypsin (1:50) (Promega, Walldorf, Germany) for 4 h at 800 rpm and 42°C or thermolysine (1:50 ...
-
bioRxiv - Cell Biology 2020Quote: ... Proteins bound to beads were digested with 1 μg of Trypsin/Lys-C mix (Promega) for 3 h at 37 °C and then supplemented with and additional amount of 150 ng Trypsin/Lys-C for overnight digestion on an end-over-end rotation apparatus at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were digested overnight at 37 °C by addition of 1 µg of trypsin (Promega). Thereafter ...
-
bioRxiv - Molecular Biology 2021Quote: ... and proteins were in-gel digested with trypsin (Promega, Madison, WI, USA; ratio 1:100) at 37°C overnight after de-staining ...
-
bioRxiv - Molecular Biology 2021Quote: ... chymotrypsin in a chymotrypsin/protein ratio of 1/20 (w/w) (Promega Cat. No. V1061) and incubated overnight at 25 °C or endoproteinase GluC in a GluC/protein ratio of 1/20 (w/w ...
-
bioRxiv - Developmental Biology 2022Quote: ... The 50μg of proteins were then trypsin digested overnight at 37 °C (1:25; Promega) using the filter aided sample preparation (FASP ...
-
bioRxiv - Biochemistry 2022Quote: ... Proteins were extracted by methanol-chloroform precipitation and digested with 1 μg of trypsin (Promega) in 100 mM EPPS (pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: ... followed by overnight digestion with trypsin (enzyme to protein ratio of 1:100) (Promega, Germany) at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were digested overnight at 37° C with 1 μg mass spectrometry grade Trypsin (Promega). The resulting peptide sample was acidified with 10% formic acid and 10% trifluoroacetic acid (TFA ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein detection was done using primary antibody anti-HaloTag monoclonal antibody (1:1,000 dilution, Promega), primary antibody anti-MamE polyclonal antibody (1:3,000 dilution ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein samples eluted with biotin were digested in-solution with 1 ug Trypsin/LysC (Promega) overnight at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Promega, Madison, WI, USA) was diluted to 10,000 genome copies per μl then serially diluted to 10 genome copies per μl and used to create a human DNA copy number standard curve ...
-
bioRxiv - Molecular Biology 2019Quote: ... The natural templates include purified human (Promega), rhesus monkey (BioChain) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10.0 ng/ml recombinant human FGF (Promega) and 1.0 μM dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human Genomic DNA Male (Promega, cat # G1471) and IDH1 R132H Reference Standard (Horizon ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50ng of normal human genomic DNA (Promega) was used as a negative control ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human LAMA1 cDNA was purchased from Promega and sub-cloned into pLVX-Tet-On Advanced vector (Clontech) ...
-
bioRxiv - Genomics 2021Quote: Commercial human DNA (Promega, Cat. No. G1521) was used for PCR amplification of all tested genome fragments from AF associated loci (for primers used see Supplementary Table S1 ...
-
bioRxiv - Microbiology 2023Quote: ... Human gDNA (Promega, San Luis Obispo, CA) was added to the extracted gDNA from the clinical swabs to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Immunology 2022Quote: ... These included 5μg/ml human gDNA (Promega), 500ng/ml citrullinated histones (Cayman Chemical #501620) ...
-
bioRxiv - Genomics 2023Quote: ... Human male genomic DNA (Promega, CAT #G1471) was used for a standard curve at 125 pg/µL ...
-
bioRxiv - Biochemistry 2024Quote: ... a K562 human peptide digest standard (Promega) and E.coli peptide standard (Waters ...
-
bioRxiv - Cancer Biology 2021Quote: Trypsin digestion was carried out overnight at 37 °C with 1:50-1:100 enzyme– protein ratio of sequencing grade-modified trypsin (Promega V5111) in 50 mM NH4HCO3 pH 7.5 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pEGFP-C1-human Rab29 was generated by inserting human Rab29 sequence from pFN21A-Halo-Rab29 (Promega, #FHC08084) into Bgl II - Eco RI site of pEGFP-C1-rat Rab29 plasmid that was used previously11 ...
-
bioRxiv - Physiology 2020Quote: ... oligo-dT primed cDNA was synthesized from 500 ng of total RNA using Murine Moloney Leukaemia Virus reverse transcriptase (Promega, USA). qRT-PCR was performed using a ViiA Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... the cell viability of each infected virus variants was measured using CellTiter 96 Aqueous One solution Cell Proliferation Assay (Promega, USA). The relative cell viability was calculated by normalizing the absorbance value of treated virus samples against untreated virus samples ...
-
bioRxiv - Cell Biology 2021Quote: ... The primary MEFs were immortalised by transfection of 2 μg of simian virus 40 large T-antigen-expressing vector employing Fugene 6 Transfection Reagent (Promega, E2311) followed by five rounds of a 1 in10 split to achieve 1/100,000-fold splitting ...
-
bioRxiv - Microbiology 2022Quote: ... We performed duplicate serial dilutions using supernatants collected from the virus rescues and measured luciferase expression at each dilution using Bright-Glo Luciferase Assay System (Promega, E2610). Virus titers were calculated as relative light units (RLU ...
-
bioRxiv - Molecular Biology 2023Quote: ... Produced pseudoviruses were titrated on HEK-293T-ACE2 by performing duplicate serial dilutions and virus titers were measured 48 hours after infection using Bright-Glo Luciferase Assay System (Promega, E2610).
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were incubated at 37 °C for two days and the nLuc activity from the virus replication was measured by using Nano-Glo® Luciferase Assay System (Promega) following the manufacturer’s protocol using a plate reader (HT4 Biotek) ...
-
bioRxiv - Immunology 2024Quote: ... The virus neutralization titers were determined by measuring the NLuc activity using the Nano-Glo Luciferase Assay System (Promega, Madison, WI) following the manufacturer’s conditions ...
-
bioRxiv - Biochemistry 2022Quote: ... The proteins were digested with 1 μg lysyl endopeptidase (LysC) (FUJIFILM Wako Pure Chemical Corporation) and 1 μg trypsin (Promega, Tokyo, Japan) overnight at 37°C on a shaking incubator ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were digested by incubation with sequencing-grade modified trypsin (1/50 w/w; Promega, V5113) for 12 h at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Proteins were digested into peptides with 12μL of 1:10 Trypsin Gold (Promega, Madison, Wisconsin, V528A) in 50mM TEAB per sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were digested by incubation with sequencing-grade modified trypsin (1/50 w/w; Promega,V5113) for 12 h at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... proteins were digested for 6 h at 37°C with 4ng.μL−1 of modified trypsin (Promega) dissolved in 50 mM NH4CO3 ...
-
bioRxiv - Neuroscience 2019Quote: ... Proteins were digested overnight at 37°C with 1 μg of mass spectrometry grade Trypsin (Promega). The resulting peptide samples were cleaned up for mass spectrometry in a Sep-Pak C18 column (Waters ...