Labshake search
Citations for Promega :
201 - 250 of 4431 citations for Arg8 Vasopressin AVP Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... (Promega #E1941, diluted 1:5 with water). Dual-Glo Luciferase assays were performed to measure Firefly and Renilla luciferase activity (Promega #E2940) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM UDP-glucose (UDP-Glc, Promega), 20 mM MgCl2 and 30 mΜ cyclic-di-GMP (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl 5x optimized transcription buffer (Promega), 2 µl T7 RNA polymerase (20 U.ml-1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... viable cells were quantified in a FLUOstar OPTIMA ELISA reader (550/590 nm) about 2 h after CellTiter-Blue staining (Promega, Cat No. G8081). Mean values +/-standard deviations (SD ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plates were imaged using a GloMax Discover Microplate Reader (Promega). Analysis and statistical test were performed using Microsoft Excel.
-
Molecular profiling of driver events and tumor-infiltrating lymphocytes in metastatic uveal melanomabioRxiv - Cancer Biology 2019Quote: ... the luminescence was measured with GloMax Discover plate reader (Promega). In parallel the manual cell count was performed using Trypan blue staining of cells obtained from transfections in 12-well format.
-
bioRxiv - Neuroscience 2020Quote: ... plates were processed with a luciferase assay (One-Glo, Promega) and luminescence was detected in a microplate reader (Synergy H1 ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were removed and 50 μl of CellTiter-Glo (Promega) was added to each well ...
-
bioRxiv - Genomics 2021Quote: ... The DNA was quantified using a GloMax Plate Reader (Promega).
-
bioRxiv - Genetics 2020Quote: ... Plates were read using a GloMax Multi-Detection System (Promega).
-
bioRxiv - Microbiology 2020Quote: ... Growth curves were obtained using a GloMax plate reader (Promega).
-
bioRxiv - Microbiology 2021Quote: ... The plate was analysed using the GloMax multidetection system (Promega).
-
bioRxiv - Immunology 2021Quote: ... Plates were then read using the GloMax® Navigator (ProMega) using the Promega GloMax® Luminiscence Quick-Read protocol ...
-
bioRxiv - Immunology 2022Quote: ... Plates were read for luminescence using the GloMax system (Promega) with pre-installed settings.
-
bioRxiv - Genomics 2022Quote: ... Plates were read on a GloMax 96 Microplate Luminometer (Promega) using the standard CellTiterGlo program.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Samples were quantified using the GloMax Plate Reader System (Promega) using the QuantiFluor® dsDNA System (Promega) ...
-
bioRxiv - Neuroscience 2023Quote: ... plates were injected with 25 μl of GloSensor substrate (Promega) and incubated for 2 h in the dark at room temperature and in an odor-free environment ...
-
bioRxiv - Biochemistry 2022Quote: ... plates were injected with 25 μl of GloSensor substrate (Promega) and incubated for 2 hours in the dark at room temperature and in a odor-free environment ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we measured luminescence on a Glomax Discovery plate reader (Promega). For crystal violet (CV ...
-
bioRxiv - Microbiology 2019Quote: ... 500 nM of each primer (5’-TCCTGCTCAACTTCCTGTCGAG-3’ and 5’-CACAGGTCAAACCTCCTAGGAATG-3’) and 0.1 µL hot-start Taq DNA polymerase (Promega) in 20 mM Tris−HCl pH 8.3 ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...
-
bioRxiv - Plant Biology 2022Quote: ... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
bioRxiv - Neuroscience 2023Quote: ... Equilibrated cells were transfected with 0.8 μg of 5-HT1eR or 5-HT1FR and 8 μg of GloSensor plasmid (Promega), after mixing with 17.6 μl of PEI in OptiMEM (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... Standard RNA was synthesized from a partial region of the GPC gene using the forward (5’-TAATACGACTCACTATAGGGCCAACCTTTTTGCAGGAGGC-3’) and reverse (5’-AGCTTCTTCTGTGCAGGATCTTCCTGCAAGCGCTAGGAAT-3’) primers and the T7 RNA polymerase (Promega), as previously described (Pemba et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination was amplified using primers PV3-F2 (5′-CTCCAAAGTCCGCATTTACA-3′) and PV1-R2 (5′-ATCAGGTTGGTTGCTACA-3′) and Taq polymerase (Promega) with an initial denaturing at 95°C for 2 min ...
-
bioRxiv - Cell Biology 2019Quote: ... The full-length coding sequence of murine Tmem98 was amplified from a mix of murine embryonic and murine keratinocyte cDNA using forward 5’-AAAAAGCTTGCCATGGAGACTGTGGTGATCGTC-3’ and reverse 5’-TTTTGAATTCTTAAATGGCCGACTGTTCCTGCAGGAAGC-3’ primers and cloned into pSP72 (Promega) as a HindIII/EcoRI fragment ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 μL of 5× Green GoTaq® Flexi Buffer and 0.25 μL of 5U GoTaq® DNA Polymerase (Promega, USA) in a total volume of 25 μL ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of each primer (C1105 5’-GGTTCATCGACATCTCCGCG-3’ and C1106 5’-AGGTCGCTGCGCATGCCAATC-3’) and 1.25 units of GoTaq® DNA polymerase (Promega). The cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Cancer Biology 2022Quote: SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
bioRxiv - Cancer Biology 2019Quote: ... Sense (5’-AGGAAACTGAAAAACAGAGTAGCAGC-3’) and antisense (5’-TCCTTCTGGGTAGACCTCTGG-3’) primers were used in a standard GoTaq Green PCR reaction (Promega) to amplify a region spanning the 26-nucleotide intron that includes a single PstI restriction site ...
-
bioRxiv - Molecular Biology 2019Quote: ... Purification of tRNAPhe(GAA) was performed using a 5’ biotinylated complementary oligonucleotide (5’-biotin-TGGTGCCGAAACCCGGGATTGAACCGGGG-3’) coupled to Streptavidin Magnesphere Paramagnetic particles (Promega). Annealing of specific tRNA was performed in 1 x TMA buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 µg/ml RNAsin (Promega, Cat#: N2511). The cells were collected through scraping and homogenised by pipetting ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 ng/μl of sequencing-grad trypsin (Promega) was added and proteins digested overnight at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL/mL RNasin Plus (Promega, cat. #N2611) was added 10 minutes before use ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 ng of Renilla luciferase report (Promega) were co-transfected into U87 human primary glioblastma cells by using ESCORT V transfection reagent (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 ng of pGL4.53(luc2/PGK) vector (Promega), 1 ng of pNL plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL Pfu DNA Polymerase 10X Buffer (Promega), 1 μL Pfu DNA Polymerase (Promega) ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with 5 μL RNase inhibitor (Promega # N2615), 100 μL 5X reaction buffer (750 mM NaCl ...
-
bioRxiv - Neuroscience 2019Quote: ... Then 5 μL of MTase reagent B (Promega) were added to all of the wells ...
-
bioRxiv - Zoology 2020Quote: ... 10 μL 5× PCR buffer (Gotaq flexi, Promega), 8 μL 25mM MgCl ...
-
bioRxiv - Genomics 2020Quote: ... 5 x RT Improm II reaction buffer (Promega), 50 ng hexanucleotides ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 μl of DNase I (Promega, M6101) at 37 °C for 20 min ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... 5 μL of GoTaq qPCR Master Mix (Promega), and 250 nM primer (Supplementary Table S2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl NanoGlo substrate (Promega GmbH, Germany, #N1110) diluted 1:100 in the supplied lysis buffer and was mixed with the 50 μl culture in a white 96-well plate and bioluminescence was determined after 3 min incubation using an Orion II Microplate Luminometer (Berthold Technologies GmbH and Co ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of NanoBiT Nano-Glo reagent (Promega N2012 ...