Labshake search
Citations for Promega :
201 - 250 of 3575 citations for 7H 9 6 Methenofuro 2 3 f oxacycloundecin 2 7 3H dione 3a 4 5 9 10 12a hexahydro 11 methyl 3 methylene 3aR 9S 11E 12aS 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Cell Biology 2021Quote: ... treated with 3 units/sample of DNase I for 2 hours (Promega, Madison, WI, USA), and 1-3μl aliquots were taken for reverse transcription (RT ...
-
bioRxiv - Biochemistry 2022Quote: ... 2) chymotrypsin and lysyl endopeptidase (lys-C) (Fujifilm Wako) 3) lys-C and trypsin (Promega) and 4 ...
-
bioRxiv - Microbiology 2020Quote: ... membranes were incubated in a 0.165 mg/ml BCIP (5-bromo-4-chloro-3-indolyl phosphate, Promega)/ 0.33 mg/ml NBT (p-nitroblue tetrazolium chloride ...
-
bioRxiv - Immunology 2022Quote: ... Caspase-Glo® 8 and Caspase-Glo® 9 (all Promega) kits were used as previously described (57) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50mM Tris-HCl pH 9 and 2U DNAse (Promega, no. M6101). The virus was incubated for 10 min at room temperature and then centrifuged at 20,000xg ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Biochemistry 2022Quote: 2’-Deoxythymidine-5’-triphosphate (dTTP) and 2’-deoxyguanosine-5’-triphosphate (dGTP) were obtained from Promega. 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP ...
-
bioRxiv - Cancer Biology 2020Quote: Cell death was analyzed using Caspase-Glo 3/7 Assay (Promega, Madison, WI), according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... was measured using the Caspase-Glo-3/7 kit ((Promega, Madison, WI, USA). The luminescence assay was measured using Biotek Synergy H1 microplate reader (Biotek ...
-
bioRxiv - Neuroscience 2019Quote: ... caspase activity was quantified using the Caspase-Glo 3/7 Assay Kit (Promega). Cell viability was detected using the CytoPainter Live Cell Labeling Kit (Abcam ...
-
bioRxiv - Biochemistry 2020Quote: ... the Caspase-Glo 3/7 reagent (G8092/G8093 kit; Promega, Madison WI, USA) was prepared at room-temperature according to the manufacturer′s specifications ...
-
bioRxiv - Biochemistry 2022Quote: ... Apoptosis was measured using the Caspase-Glo® 3/7 assay system (Promega). Cells were seeded at a density of 1 × 104 in 96-well black polystyrene microplates (Corning) ...
-
bioRxiv - Cell Biology 2022Quote: ... Apoptosis was measured with the caspase-Glo 3/7 assay (Promega Cat# G8092), following manufacturer recommendations.
-
bioRxiv - Molecular Biology 2022Quote: Active caspases were detected using the Caspase-Glo 3/7 Assay System (Promega). The experiment was set up using the same protocol as proliferation assay ...
-
bioRxiv - Neuroscience 2023Quote: ... Caspase activity was quantified using the Caspase-Glo 3/7 Assay Kit (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... Cell viability and caspase 3/7 activity was measured with CellTiter Flo (Promega) or CaspaseGlo (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability and caspase 3/7 activity was measured with CellTiter Glo (Promega) or Caspase Glo (Promega ...
-
bioRxiv - Bioengineering 2023Quote: ... the Caspase-Glo 3/7® or Caspase-Glo 8® assay (Promega) was performed according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... and apoptosis was determined using the Caspase 3/7 Glo Assay (G8090, Promega) measuring luminescence with a BioTek Synergy 2 (BioTek/Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: ... or the Caspase Glo® 3/7 Assay (Promega Corporation, Madison, WI, USA) following the manufacturer’s protocol and plates were read on an EnVision Multilabel Plate Reader (Perkin Elmer ...
-
bioRxiv - Cancer Biology 2024Quote: Apo-ONE® Homogeneous Caspase-3/7 Assay (Promega Corporation, Madison, WI, USA) was used to determine the caspase activity in the extracted tumors ...
-
bioRxiv - Biochemistry 2020Quote: ... Each well was transfected with 3 uL FuGENE 6 reagent (Promega) and 130 ng pcDNA3-mouseSTING in line with manufacturer’s protocols.
-
bioRxiv - Molecular Biology 2023Quote: ... Figure 6 and Figure 7) to form condensates in cells was monitored by transient transfection of U-2 OS cells using FuGene (Promega; Figures 2 and 7) or electroporation (as before ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and Bone Morphogenetic Protein 4 (BMP4, 10 ng/ml, Bio-Techne) plus phosphoinositide 3-kinase inhibitor Ly294002 (10 µM, Promega). After 42 h incubation at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... wild type or mutant 3′-UTR of DKK3 was cloned into the psicheck-2 vector (Promega). HCT116 cells were transfected with and wild-type or mutant 3′-UTR-luc by using Lipofectamine 3000 ...
-
bioRxiv - Plant Biology 2021Quote: ... 2-3 μg of the purified RNA was in vitro translated using wheat germ extract (Promega) at 25 °C for 2 h as per the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... Cytotoxicity was measured using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT) assay kit (Promega) by determining Formazan absorbance at 590 nm on a Tecan Safire automated plate reader ...
-
bioRxiv - Plant Biology 2023Quote: ... LUC images were taken 2-3 days after infiltration by applying 1 mM Beetle luciferin (Promega) on adaxial leaf surface.
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Physiology 2019Quote: ... Plasmid DNA (6 µg) was mixed (1 : 3 ratio) with transfection reagent (Fugene 6; Promega, UK) in reduced serum media (OptiMEM ...
-
bioRxiv - Molecular Biology 2019Quote: ... 20 μl of f/2 and 10X concentrated substrate (10 mM firefly luciferin, 1,000X dilution of NanoLuc Dual-Glo reagent, Promega) were added to the respective wells.
-
bioRxiv - Molecular Biology 2020Quote: ... [9] with minor modifications including the use of Magnetic Halolink beads (Promega). The PUM test proteins remained covalently bound via N-terminal Halotag to the beads.
-
bioRxiv - Cancer Biology 2023Quote: Caspase3/7 activity was quantified in cell lysates using the Kit Caspase-Glo® 3/7 Assay Systems (G8091, Promega).
-
bioRxiv - Cell Biology 2020Quote: ... Caspase 3/7 activity was measured using an Apolive-Glo kit (Promega, Madison, WI) and measured using a SpectraMax M5 (Molecular Devices ...
-
bioRxiv - Physiology 2020Quote: ... caspase 3/7 activity was measured using ApoLive-Glo Multiplex Assay (Promega, Madison, WI). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell apoptosis was assessed using either the CaspaseGlo 3/7 assay (G8090, Promega, UK) according to the manufacturer’s instructions (N=4 replicates) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Effector caspase activity was assessed using the Caspase-Glo 3/7 Assay System (Promega) following a previous protocol (Ronai et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal volume of Caspase-Glo® 3/7 Assay System (Cat. No.G8090, Promega) was transferred into each well and incubated for 1 h and measured by a GloMax® 20/20 Luminometer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and caspase-3/7 activity were measured using the ApoTox-Glo Triplex Assay (Promega) in a GloMax-Multi+ Reader (Promega) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Apoptotic activity was determined by the Caspase-Glo 3/7 luminescent assay (Promega, G8092), Annexin-V staining (Roche ...