Labshake search
Citations for Promega :
201 - 250 of 5489 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... pMD2.G and the lentiviral gRNA plasmid at a 3:1:5 mass ratio using FuGENE HD (Promega) in Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... 5-GGATCCACACGGTGCAAAGAGAGACCC-3’ and 5′-TCGGCCTTTCAGACTAATCTTATCAGC-3’ The PCR products were gel purified and cloned into the pGEM-T vector (Promega; Madison, WI, USA). The inserted PCR fragments of individual clones were sequenced by Tsing KE Biological Technology ...
-
bioRxiv - Biochemistry 2024Quote: ... GSK-3 (Promega), CK1 (Promega) ...
-
bioRxiv - Cell Biology 2020Quote: ... in 2× SSC supplemented with 3% (vol/vol) RNasin Ribonuclease inhibitor (Promega), 6% (vol/vol ...
-
bioRxiv - Cell Biology 2019Quote: ... The reaction was diluted 1:4 with 50 mM ammonium bicarbonate and incubated with 1 µg of Trypsin Gold (Promega) at 37°C for more than 18 h before desalting ...
-
bioRxiv - Immunology 2020Quote: Caspase-1 and Caspase 3/7 activities were measured using Caspase-Glo® 1 and Caspase-Glo® 3/7 assay (Promega) respectively ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were incubated at 30 °C and luminescence was quantified after 2 h and 4 h post infection (20 μl sample plus 20 μl substrate, Nano-Glo® Luciferase Assay System, Promega). The sample was carefully removed from the upper part of the tube without disturbing the sedimented erythrocytes in the blood samples.
-
bioRxiv - Immunology 2021Quote: ... cDNA were synthesized from RNA (4 μg) using AMV Reverse Transcriptase (Promega). ...
-
bioRxiv - Immunology 2021Quote: CTLA-4 Blockade Bioassay was purchased from Promega (JA3001; Madison, WI, USA) and performed according to the manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2019Quote: ... during 4 h then with trypsin (Sequencing Grade Modified, Promega, Madison, WI) overnight ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1.6 μg DNA and 4 μl FuGENE HD transfection reagent (Promega, E231A) was used for 6-well format transfection according to the manual ...
-
bioRxiv - Genetics 2019Quote: ... after reducing SDS-PAGE on a gradient (4-15%) polyacrylamide gel (Promega) and transfer onto nitrocellulose membrane ...
-
bioRxiv - Systems Biology 2020Quote: ... initially for 4 hours with 1.5 μl trypsin (0.5 μg/μl; Promega) and then another 1-2 hours with 0.5 μl additional trypsin ...
-
bioRxiv - Neuroscience 2023Quote: ... to an agar block (4% agarose, low melting point, analytical grade, Promega, Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were digested with 4 ug Trypsin/Lys-C mix (Promega V5073) for 3-4 hrs at 37°C ...
-
bioRxiv - Systems Biology 2023Quote: ... initially for 4 hours with 1.5 μl trypsin (0.5 μg/μl; Promega) and then another 1–2 hours with 0.5 μl additional trypsin ...
-
bioRxiv - Cell Biology 2023Quote: ... After addition of 4 μl of RNAsin Plus ribonuclease inhibitor (Promega N2611), the samples were spun down ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 µL furimazine (0.36% vol/ vol diluted in BRET assay buffer, Promega) was added before readout on ClarioStar.
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-cleaved Caspase-3 (1:500 dilution, Promega), mouse anti-GFP (1:1,000 dilution ...
-
bioRxiv - Cell Biology 2024Quote: ... for 3 h and with trypsin (1:25, Promega) for 16 h both at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... freshly add 3 µL 1:1 water diluted digitonin (Promega G9441)) was added ...
-
bioRxiv - Molecular Biology 2022Quote: Lentivirus particles were collected from HEK293T cell supernatant 3 days after co-transfection (FuGENE 6, Promega) of lentiviral plasmid constructs (Supplementary Table 2A ...
-
bioRxiv - Microbiology 2019Quote: ... cells were pelleted at 1000 rcf for 5 min at 4 °C and resuspended in luciferase reporter lysis buffer (Promega, Cat. #E4530) with 1% protease inhibitor cocktail (Millipore Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated for 24-48hrs in the blocking solution containing chicken anti-human NT-4/5 antibody (10 mg/ ml, Promega, Madison, WI) or rabbit anti-human NT-4/5 (1:1000 ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by the secondary antibody for 1 h at +4 °C (anti-rabbit IgG-HRP, Promega 65-6120). The Pierce® enhanced chemiluminescence substrate (Thermo-Fischer Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... the beads with bound recombinant proteins were blocked for 1 h at 4°C using reticulocyte lysate (Promega). Next ...
-
bioRxiv - Systems Biology 2023Quote: ... Samples were diluted 1:4 with 50 mM Tris/HCl (pH 8.0) and sequencing grade modified trypsin (Promega) was added in an enzyme-to-substrate ratio of 1:50 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the appropriate protein amount (60 μg for baseline expression experiments and 1mg for perturbation experiments) was digested with LysC (1:100, Wako, #121-05063) for 4 h and Trypsin (1:75, Promega, #V5113) overnight ...
-
bioRxiv - Cancer Biology 2019Quote: ... The cell viability was assessed by the viability assays 3-(4,5-dimetiltiazol-2-il)-5-(3-carboximetoxifenil)-2-(4-sulfofenil)-2H-tetrazolio (MTS) using the Cell-Titer 96c AQueous Non-Radioactive Cell Proliferation Assay kit (Promega, Madison, USA) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... with an added 5’-CACC-3’ at 5’-end and 5’-AAAC-3’ at 5’-end of the complementary strand were annealed in 10xT4 ligation buffer (Promega M1801) by continuous cooling from 95°C to 25°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... the two blots were hybridized O/N at 65 °C to each their radioactively labeled 3’ CF probe (AGO1 3’ CF and CSD2 3’ CF probes labelled with Prime-a-gene labeling kit from Promega). The membranes were washed 3 times in 2xSSC (0.3 M NaCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase-Glo 3/7 Reagent (Caspase-Glo® 3/7 Assay, Promega) was added to the wells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Caspase 3/7 activity was detected using Caspase-Glo 3/7 (Promega). Annexin V/Propidium Iodide staining was performed using Alexa Fluor 488 Annexin V/Dead Cell Apoptosis Kit (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... caspase-3/7 levels were examined using Caspase-Glo 3/7 (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2020Quote: ... Cell viability was assayed 4 days post-seeding by Cell Titer Glo (Promega) and an Envision plate reader ...
-
bioRxiv - Pathology 2023Quote: ... 0.08 µL of GoTaq2 and 4 µL of its 5x corresponding buffer (Promega), and 5 µL of boiled calibrated bacterial suspensions ...
-
bioRxiv - Systems Biology 2023Quote: ... 4 μL of digestion buffer containing 20 ng/μL sequencing-grade trypsin (Promega), 20 ng/μL sequencing-grade Lys-C (Wako) ...
-
bioRxiv - Microbiology 2021Quote: ... or 3) Pepsin (Promega). 1 ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 µL RNasin (Promega) and 100 µL lysis buffer for a total volume of 300 µL for IP by rotation for 2 hours at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... samples were incubated for 6 h at 37°C with 3 μg Sequencing Grade Modified Trypsin (Promega). Digestion was terminated via addition of 20 μL trifluoroacetic acid (TFA) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 500 ng of pMCB306 plasmids described above along with 3 µl of Fugene 6 (E2692, Promega) transfection reagent ...
-
bioRxiv - Cell Biology 2020Quote: ... at a protein:Lys-C ratio of 100:1 (w/w) for 4 h at 37°C followed by trypsin (Promega) digestion at a ratio of 50:1 (w/w ...
-
bioRxiv - Cancer Biology 2022Quote: The 4T1-mScarlet and 67NR-GFP cell lines were generated by transfection using a 1:4 ratio of plasmid DNA:FugeneHD reagent (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... Tryptic digests were performed overnight after addition of 46 μl of 100 mM Hepes pH 7.6 and 4 μl of 1 μg/μl Trypsin Gold (Promega).
-
bioRxiv - Cell Biology 2021Quote: ... at room temperature (r.t.) for 4 hours and then further digested overnight with 1:50 (w/w) trypsin (Promega) at r.t ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 µL of 1:100 (diluted in phenyl red-free DMEM with 4% FBS) Nano-Glo substrate (Promega N1572) was added in each well ...
-
bioRxiv - Plant Biology 2023Quote: ... Two µl of cDNA (1:4 dilution) was added to a 20µl qPCR reaction using the GoTaq qPCR Master Mix (Promega) and ran on a BioRad CFX Opus96 thermocycler ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2019Quote: ... 3 μg of RNA was treated with DNase 1 (Promega) for 2 hours at 37°C ...