Labshake search
Citations for Promega :
201 - 250 of 1285 citations for 5 Isoxazolemethanol 3 3 fluorophenyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2021Quote: ... The endpoints of the second screen were caspase 3/7 activity measured using the CaspaseGlo® 3/7 assay reagent (Promega) at the 8-hour and 16-hour time intervals ...
-
bioRxiv - Cancer Biology 2020Quote: CellTiter 96 AQueous One Solution Cell Proliferation Assay MTS 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) was used according to the manufacturer’s protocol (Promega, Madison, WI) to assess proliferation of cells cultured in 96-well plates.
-
bioRxiv - Cell Biology 2020Quote: ... at 3500 cells/well and cell proliferation over 3-5 day periods was determined by measuring luminescence with CellTiter-Glo® assay kit (G7570, Promega), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: The crRNA (5’-AAUUUCUACUGUUGUAGAUGUGAUAAGUGGAAUGCCAUGUGGG-3’) was synthesized and purified using the T7 RiboMAX™ Express Large Scale RNA Production System (Promega). The following DNA templates were used for the in vitro transcription reaction ...
-
bioRxiv - Zoology 2024Quote: ... The amplicon target was amplified from WNV cDNA using the qPCR primers with the forward primer flanked by T7 sequence (5’-TAATACGACTCACTATAGGGATTCGGGAGGAGACGTGGTA-3’) and transcribed using T7 RiboMAX Express Large Scale RNA Production System kit (Promega, France). RNA was purified by ethanol precipitation ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’int-F and 24nt-6stp-R primers and 2) 3’KI: 24nt-6stp-F and 3’int-R using the GoTaq DNA polymerase mix (Promega, Madison, WI) and 200 nM of each primer ...
-
bioRxiv - Cell Biology 2021Quote: ... Caspase 3/7 activity was measured 24 hours post-cytokine treatment using the Caspase-Glo® 3/7 Assay System (Promega, #G8090).
-
bioRxiv - Cancer Biology 2022Quote: ... Apo-one Homogeneous Caspase-3/7 Assay kit was performed according to the manufacturer’s protocol to calculate caspase 3/7 activity (Promega Corporation, Madison, WI). Additionally ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: To determine Caspase 3/7 activity in THP-1 SAMHD1 KO and CTRL cells the Caspase-Glo 3/7 assay (Promega, Walldorf, Germany) was used according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: Caspase-1 and Caspase 3/7 activities were measured using Caspase-Glo® 1 and Caspase-Glo® 3/7 assay (Promega) respectively ...
-
bioRxiv - Cancer Biology 2022Quote: ... cell viability and caspase 3/7 activity were evaluated using CellTiter-Glo and Caspases-Glo 3/7 assays (both from Promega, Madison, WI), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Caspase 3/7 activity was quantified in cell culture by using the Caspase-Glo 3/7 assay system (Promega, Madison, WI, USA). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μL containing 3 units of DNase I (Promega) and 1 μL of CaCl2 was added ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 µL/well of Caspase 3/7 reagent (Promega) was added per the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-cleaved Caspase-3 (1:500 dilution, Promega), mouse anti-GFP (1:1,000 dilution ...
-
bioRxiv - Immunology 2019Quote: ... and Caspase-Glo® 3/7 assay kit (Promega). A volume of 100 μL cells was placed in a 96-well plate ...
-
bioRxiv - Cancer Biology 2019Quote: ... named Caspase-Glo® 3/7 assay (G8091, Promega). The assay was performed following the manufacturer’s protocol in white polystyrene 96-well plates (Nunc ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the Caspase-Glo® 3/7 assay (Promega).
-
bioRxiv - Biochemistry 2022Quote: ... 3 ng/μL trypsin (Trypsin Gold, V5280, Promega, USA), 0.01 % enhancer (ProteaseMAX™ ...
-
bioRxiv - Cancer Biology 2023Quote: The Caspase-Glo® 3/7 Assay System (Promega), a luminescence-based assay for detection of active caspase-3 and 7 ...
-
bioRxiv - Cell Biology 2023Quote: Promega’s Capsase-Glo 3/7 Assay kit (G8093, Promega) was used to measure caspase activity according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Caspase-Glo 3/7 Assay System (Promega, cat # G8091) was used to quantify activated cellular caspase 3/7 per manufacturer protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... For the Caspase-Glo 3/6 Assay (Promega #G8092), Caspase-Glo 3/7 reagent was added to the cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... Caspase-Glo 3/7 Assay System (Promega, Cat. G8091) was used to measure the activity of caspase-3 and caspase-7 ...
-
bioRxiv - Immunology 2024Quote: ... IVT mRNA (3 pmol) and 10U RNase inhibitor (Promega) were then added to the cell suspension ...
-
bioRxiv - Cell Biology 2024Quote: ... for 3 h and with trypsin (1:25, Promega) for 16 h both at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: Induction of apoptosis after 24 h of doxorubicin treatment was quantified by analyzing Caspase 3/7 activity using the Caspase-Glo® 3/7 3D assay (Promega, Madison, WI). The assay protocol was followed from the manufacturer’s website ...
-
bioRxiv - Biochemistry 2022Quote: The 4330bp PCR product amplified from M13mp18 by using primers: oM13-5-27 and oM13-3-24 was inserted into pGEM®-T Easy(PROMEGA #A137A). The resultant plasmid is named as pM13 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-goat alkaline phosphatase-linked antibody and alkaline phosphatase substrate (5-bromo-4-choloro-3-indolyl 1-phosphate and nitroblue tetrazolium) from Promega (Southampton, UK); a hydroxamate-based MMP inhibitor CT-1746 (N1-[2-(S)-(3,3-dimethylbutanamidyl)]-N4-hydroxy-2-(R)-[3-(4-chlorophenyl)-propyl]-succinamide ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... RBD-R: 5′-TGC CTC GAG CTC AAG TGT CTG TGGATC AC-3′) into pGEM T-easy vector (Promega, Madison, WI, USA). A standard curve was generated by determining the copy numbers derived from serial dilutions of the plasmid (103–109 copies) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cell viability was assessed using the 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) CellTiter 96 Aqueous One Solution Cell Proliferation Assay (Promega, Madison, WI) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 3 μg of RNA was treated with DNase 1 (Promega) for 2 hours at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... we mixed 3 ng/μL of lambda DNA (D1501, Promega) and 5 nM of condensin in an Eppendorf tube for a 10 min incubation to induce condensin-DNA interaction ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell viability was measured 3 days later using CellTiterGlo (Promega).
-
bioRxiv - Microbiology 2021Quote: ... in a 3:1 ratio of FuGENE®HD (Promega) transfection reagent to DNA ...
-
bioRxiv - Immunology 2020Quote: ... the protein suspension was digested with 3 μg trypsin (Promega) in 40 μl 25 mM NH4HCO3 overnight at 37 °C ...
-
bioRxiv - Immunology 2022Quote: ... (3) we used ProNex Size-Selection DNA purification System (Promega) for purification of PCR product ...
-
bioRxiv - Cancer Biology 2019Quote: ... cleaved caspase 3 was visualized with antibody (Promega Cat # G7481)) labeled with Qdot 655 Streptavidin conjugate (Thermo Cat# Q10121MP) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Apoptosis was assessed with Caspase-Glo 3/7 assay (Promega) according to the manufacturer’s instruction.
-
bioRxiv - Genetics 2021Quote: ... and Caspase-Glo® 3/7 Assay System (Promega, G8090), respectively ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... followed by 3 h at 37°C using trypsin (Promega). All proteolytic digests were acidified to pH 2 by addition of 10% formic acid and directly analyzed by LC-ESI-MS/MS ...
-
bioRxiv - Neuroscience 2022Quote: ... in combination with Caspase-Glo® 3/7 Reagent (Promega) [33] ...
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... we utilized BetaFluor β-gal assay kit (Promega 70979-3) to distinguish between Kif17+/- and Kif17-/- littermates at postnatal day 8 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The caspase 3/7 Glo assay (Promega, Madison, WI, USA) was performed on the white plates according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... the permeabilization protocol used a 3 minute 0,02% digitonin (Promega) exposure ...
-
bioRxiv - Cell Biology 2022Quote: ... and caspase-3/7 assay (Cat # G8090, Promega, Madison, WI) were performed using commercially available kits as per the instructions to assess proliferation and apoptosis ...
-
bioRxiv - Cancer Biology 2023Quote: ... after which 3 μL of CellTiter-Glo reagent (Promega, G7572) was added to each well ...
-
bioRxiv - Immunology 2023Quote: ... Tissues were embedded in 3% low melting point agar (Promega). Formalin embedding ...