Labshake search
Citations for Promega :
201 - 250 of 1788 citations for 2 4 Methyl 5 thiazolyl ethyl decanoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of buffer (5x, Promega®), 1.5 μl of MgCl2 (25mM ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of buffer (5x, Promega®), 1.5 μL of MgCl2 (25 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 µL GoTaq polymerase buffer 5x (Promega), 0.5 μL of each primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 units RNasin Plus RNase inhibitor (Promega) as described (Lee et al ...
-
bioRxiv - Biochemistry 2020Quote: ... or 5:1 (w/w) Elastase (Promega), using manufacturer recommended temperatures for 18 h with 600 rpm shaking ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of HiBiT lytic reagent (Promega N3040 ...
-
bioRxiv - Systems Biology 2023Quote: ... and 5 μg/mL Trypsin (Promega:487603)) for 1 hour at 25°C on a shaker (1000 rpm) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of 2x GoTaq (Promega, #A600A), 0,4 µL forward primer (0,5 µM) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl 5x optimized transcription buffer (Promega), 2 µl T7 RNA polymerase (20 U.ml-1 ...
-
bioRxiv - Physiology 2024Quote: ... (Promega #E1941, diluted 1:5 with water). Dual-Glo Luciferase assays were performed to measure Firefly and Renilla luciferase activity (Promega #E2940) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM UDP-glucose (UDP-Glc, Promega), 20 mM MgCl2 and 30 mΜ cyclic-di-GMP (Sigma) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and 5% pRL-TK Luc (Promega E2241) plasmid and 100 µL of the transfected cell suspension were seeded into a white PDL-coated 96-well flat bottom plate (Nunc) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL of ADP Glo Reagent (Promega), supplemented with 0.01% Triton X-100 ...
-
bioRxiv - Genetics 2023Quote: ... and 5 μl of TransFast (Promega; E2431) in a serum-containing medium in a total volume of 500 μl and plated into one well of a 24-well plate ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 µg/mL trypsin (Promega: V511C)) for 1 hour at 25C° and 1000 rpm to partially digest the proteins of the bead–generating an initial eluate ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...
-
bioRxiv - Neuroscience 2023Quote: ... Equilibrated cells were transfected with 0.8 μg of 5-HT1eR or 5-HT1FR and 8 μg of GloSensor plasmid (Promega), after mixing with 17.6 μl of PEI in OptiMEM (Gibco) ...
-
bioRxiv - Systems Biology 2024Quote: ... The digested samples were combined with 5 μL of 6 x 5 LC-MS/MS Peptide Reference mix (Promega) and stored at-20℃ until analysis.
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies were incubated in PBDS for 3 days at 4°C followed by 4 washes over the next 24 hours with 0.2% Tween-20 (Promega UK Ltd; H5151) in PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of random primers (Promega) were added after which the mixture was incubated at 65 °C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 μg of Trypsin (Promega, V5111) was added to each sample and they were incubated shaking at 37°C overnight (o/n) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 0.25 µl of 2% digitonin (Promega) and 0.5 µl of 10% Tween-20 ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 U GoTaq Flexi Polymerase (Promega) and 0.22 µg TaqStart Antibody (Clontech) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μL Superasin RNase inhibitor (Promega), and 8 μL PEG8000 (supplied with ligase) ...
-
bioRxiv - Molecular Biology 2020Quote: The commercial psiCHECK™-2 (Promega) vector was modified by deleting the Rluc poly(A ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U μL-1 RNasin (Promega), 1 mM ATP/GTP/CTP ...
-
bioRxiv - Neuroscience 2022Quote: ... The psiCHECK-2 vector (Promega, C8021) was used to build the dual luciferase reporters with Kcnj10 UTRs ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 µl trypsin (Promega Trypsin Gold) was added pre-diluted in ultra-pure water to 2 ng/µl and incubated overnight at 37°C in the thermal cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... The psiCHECK-2 vector (Promega, C8021) and the psiCHECK-RL-Ifnb1 3’ UTR vector were described before (Zhang et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 U/μl RNaseIn Plus (Promega) and 10 U/μl SuperScript IV Reverse Transcriptase enzyme while heated ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl biotinylated Transcend tRNA (Promega) was included in the reaction mix resulting in biotinylation of lysine residues ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 U RNase-free DNase (Promega), 1 mM CaCl2 ...
-
bioRxiv - Genetics 2024Quote: The psi-CHEK-2 plasmid (Promega) was used for the luciferase assay ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μL of CellTiter-Glo® (Promega cat#: G7570) were added to each well and incubated for 15 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 mM isopropyl β-d-1-thiogalactopyranoside (IPTG; Promega) was added to each RNAi well for induction of dsRNA synthesis and plates were incubated for 3-4 hours at 30°C and 155 rpm ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Slides were then incubated with 100 nM insert/backbone oligonucleotides in PBS ...
-
bioRxiv - Immunology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Samples were washed and endogenous biotin was blocked using Avidin/Biotin blocking kit (Vector laboratories ...
-
bioRxiv - Immunology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Slides were then incubated with 100 nM insert/backbone oligonucleotides in PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... We identified a common tracer probe (K-4, Promega), suitable for all mutants ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl of 4 mg/ml RNase A (Promega) was added and the sample incubated for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 4 µL FuGene HD (Promega), 1 µg sgRNA-Cas9 plasmid DNA ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 4 µL of ONE-Glo™ Luciferase reagent (Promega) was added to each well using the BioRAPTR FRD™ ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 4 µL of ONE-Glo™ Luciferase reagent (Promega) was added to each well using the BioRAPTR FRD™ ...
-
bioRxiv - Biophysics 2022Quote: ... 4% glycerol with 12 units RNasin (Promega, Madison, WI), 10 μg/ml BSA ...
-
bioRxiv - Microbiology 2021Quote: ... Standard RNA was synthesized from a partial region of the GPC gene using the forward (5’-TAATACGACTCACTATAGGGCCAACCTTTTTGCAGGAGGC-3’) and reverse (5’-AGCTTCTTCTGTGCAGGATCTTCCTGCAAGCGCTAGGAAT-3’) primers and the T7 RNA polymerase (Promega), as previously described (Pemba et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination was amplified using primers PV3-F2 (5′-CTCCAAAGTCCGCATTTACA-3′) and PV1-R2 (5′-ATCAGGTTGGTTGCTACA-3′) and Taq polymerase (Promega) with an initial denaturing at 95°C for 2 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of each primer (C1105 5’-GGTTCATCGACATCTCCGCG-3’ and C1106 5’-AGGTCGCTGCGCATGCCAATC-3’) and 1.25 units of GoTaq® DNA polymerase (Promega). The cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...