Labshake search
Citations for Promega :
2351 - 2400 of 2934 citations for 1 Methoxy 4 1 methylbutyl benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... QRT-PCR reactions were performed by using the GoTaq®1-Step RT-qPCR System (Promega Scientific, Madison, WI, USA) with Bio-Rad CFX Connect (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated for 1 h at 37 °C with fresh complete DMEM containing JFX646 HaloTag ligand (200 nM; GA112A; Promega), washed twice with PBS 1X and imaged on an Elyra 7 with Lattice SIM² microscope (Zeiss ...
-
bioRxiv - Cell Biology 2024Quote: ... the samples were diluted with seven volumes of 50 mM ammonium bicarbonate and incubated for 16 h at 37 °C with 400 ng of trypsin (ratio 1:50; “Trypsin Gold”, Promega).
-
bioRxiv - Cancer Biology 2024Quote: ... Cell viability was assayed starting at Day 1 for 6 days according to the CellTiter-Glo 3D kit (Promega G9683). For the antiandrogen response assay ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of extracted DNA was added to an amplification mixture containing 1 µl (10 µM) of primers and 12.5 μl of PCR Master Mix Plus (Promega, USA). To each mixture ...
-
bioRxiv - Neuroscience 2024Quote: ... Afterwards the samples were diluted to decrease the concentration of urea up to 1 M and supplemented with additional amounts of sequencing-grade trypsin (Promega) (200 ng for pull-down samples and 1 ug for total lysate samples) ...
-
bioRxiv - Microbiology 2024Quote: ... SL100688) with the exception of BCBL-1 cells that were transfected with FuGENE HD transfection reagent (Promega, Cat. No. E2311,). Competition reporter assays were performed with co- transfection of the TR7 reporter plasmid with or without LANA expression plasmid (DY52) ...
-
bioRxiv - Microbiology 2024Quote: ... and the resulting products were checked on agarose gel (1%) and purified using the Wizard SV Gel and PCR Clean-Up System (Promega) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Immunology 2024Quote: ... and 1 μg of RNA used as a template for cDNA synthesis with random primers and ImProm-II reverse transcriptase (Promega). Quantitative PCR (qPCR ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: β-arrestin2 recruitment to human chemokine receptors in response to 1 µM VUF15485 or 200 nM positive control chemokines was also monitored by NanoLuc complementation assay (NanoBiT, Promega) (Dixon et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... A 250 ug aliquot was alkylated and digested by incubating overnight at 37 °C in trypsin at a ratio of 1:50 (Promega). Digestion was acidified by adding formic acid (FA ...
-
bioRxiv - Microbiology 2023Quote: ... cells were infected with HIV-1 for 48 hours before luminometric quantification of luciferase activity using the Luciferase Assay System (Promega).
-
bioRxiv - Cancer Biology 2023Quote: ... Alkylated proteins were then cleaved using a two-step digestion: first with Endoproteinase Lys-C (ratio 1:33 enzyme: lysate, Promega) for 1 hour at 37 °C then with Trypsin (ratio 1:33 enzyme ...
-
bioRxiv - Biochemistry 2024Quote: ... at a 1:75 enzyme to protein ratio for 6 h at 30 °C and then by trypsin (V5111, Promega) (1:50 enzyme to protein ratio ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Denatured proteins were enzymatically digested for 14 h at 37 °C with 1 µg of sequencing-grade Trypsin (V511A, Promega). After speed-vaccum drying ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was digested overnight at 37 °C with sequencing-grade trypsin or chymotrypsin (Promega; 1:100 protease:protein weight ratio). After desalting on a C18 column (Pierce ...
-
bioRxiv - Neuroscience 2023Quote: ... We performed targeted PCR by adding 1 μL of cell lysate (1:5 dilution) to a 25-μL PCR reaction containing GoTaq Hot Start Master Mix Green (Promega) and 0.5 μL of the primers (10 µM ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were diluted with 50 mM NH4HCO3 to a final concentration of less than 2 M urea and were further digested overnight with 1:25 (w/w) trypsin (Promega) at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Protein mixtures were diluted in 1:6 ratio (v/v) using ultrapure water prior to digestion using sequencing grade trypsin (Promega) at 37°C for 16 h ...
-
bioRxiv - Immunology 2023Quote: ... Cells were washed once with PBS and lysed for at least 1 h with 40 μl 1x passive lysis buffer (Promega) at RT ...
-
bioRxiv - Microbiology 2022Quote: RT-qPCR analyses of NoV GII were carried out using GoTaq® Probe 1-Step RT-qPCR System (Promega, USA). Primers and the FAM/TAMRA-labelled probe of hNoV GII were according to ISO 15216-1:2017 ...
-
bioRxiv - Microbiology 2023Quote: ... 100 μL of these purified Se cells or 100 μL of the corresponding Se-Ai cocultures were mixed with 100 μL Nano-Glo Luciferase assay reagent (50:1 mixture of substrate:buffer, Promega N1110) in a 96-well plate ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were washed in 1×PBST and then incubated with the secondary antibody (anti-rabbit or anti-mouse IgG conjugated with horse radish peroxidase at 1:10 000, Promega). The membranes were then revealed using an ECL kit (GE Healthcare ...
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR was used to amplify the coding regions of the steroid receptor genes and to linearize the expression plasmids pHTN HaloTag CMV Neo or pFLN-1 NanoLuc (Promega #N1811 ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Genomics 2023Quote: ... Supernatant was removed and pellet was resuspended in 400 µL of sort buffer (1 mM EDTA 0.2 U/µL RNase inhibitor (Promega, N211B), 2% BSA (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples containing 20-30 pmol rhodopsin were mixed with 100-250 fmol BSA and cleaved with 1 μg trypsin/LysC mix (Promega) using the SP3 beads protocol described in [29].
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 40,000 cells per well were seeded into poly-D-lysine-coated 96-well plates (Brand, 781965) and the Halo-ligand was added (1:2,000; Promega, G980A). For each transfection ...
-
bioRxiv - Microbiology 2023Quote: ... to a final urea concentration ˂ 2 M and then digested with modified trypsin (1:50 w/w) (Sequencing Grade, Promega) at 37°C for 3 h ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... was co-transfected at a 1:5 ratio with either the HaloTag-ubiquitin plasmid (expressing Ub-Halo) or the HaloTag control (Promega). Transfected cells were incubated for 20 h at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Isolated proteins were digested with 1:50 w/w LysC (Wako Chemicals, cleaves at the carboxylic side of lysine residue) and 1:100 w/w trypsin (Promega, Sequencing-grade ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted 1:100 in storage buffer and analyzed as indicated in the manufacturer’s protocol (LDH-Glo Cytotoxicity Assay, Promega, #J2381).
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 cells in a 6-cm dish were transiently transfected with 1 μg of pGloSensor-22F cAMP plasmid (Promega, USA) and 1 μg of human wild-type or mutated A2AR or A2BR overexpression plasmid using polyethyleneglycol (6 μl ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were plated at a density of 1*10^6 per 10cm plate and transfected on the following day using Fugene HD (Promega, Madison ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Molecular Biology 2023Quote: ... The library preparation involved using 100 ng of genomic DNA spiked with 1% (w/w) of unmethylated lambda DNA from Promega. Subsequently ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCRs were performed with MLV SU or 2-LTR primers (Table 1) using a Power SYBR green PCR kit (Promega) and the QuantStudio 5 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... and LgBiT Protein (1:100)/HiBiT Lytic Substrate (1:50) in Nano-Glo HiBiT Lytic Buffer (25 μl) (Nano-Glo HiBiT Lytic Detection System; Promega) were mixed and incubated for 10min at room temperature according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNAs were obtained from 400 ng of RQ1-treated RNA using 1 μl of GoScript Reverse Transcriptase (Cat. No. A5003; Promega) in a 20-μl final volume reaction using random primers (Cat ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were diluted 5-fold with 25 mM Tris pH 8.0 and 1 mM CaCl2 prior to digesting them with trypsin (Promega, V511X) at a 1:30 enzyme-to-protein ratio at 37 °C in a dry bath for 16 h.
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... PCR reaction mixtures were solved in 1% (w/v) agarose gel and purified using Wizard SV gel & PCR Clean-Up kits (Promega). Then ...
-
bioRxiv - Bioengineering 2023Quote: ... tumor fragments (200-300 mg) were lysed for 1 h on ice with agitation in 1X Reporter Cell Lysis Buffer (Promega) and then centrifuged at 14,000 x g for 15 min at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: ... 2000 transfected cells were replated into white 384-well tissue culture plates in the presence or absence of 1 μM HaloTag NanoBRET-618 Ligand (Promega) and incubated overnight at 37 °C ...