Labshake search
Citations for Promega :
2301 - 2350 of 4270 citations for 7 Bromo 1 2 3 4 tetrahydronaphthalen 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Viability of organoids was determined after 3 days using CellTiterGlo reagent (Cat #G9683, Promega) and detected using a FluoStar Optima Plate Reader (21999 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.006 uM and cell viability was measured after 3 days using CTG-3D (Promega). To test the response to a fixed concentration of cisplatin 20,000 cells were seeded in a 12-well plate using 3 replicates per condition ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tumoral growth was followed by bioluminescence upon injection of 3 mg luciferin-EF (Promega) using a Photon Imager device (Biospace Lab) ...
-
bioRxiv - Biophysics 2024Quote: ... LgBiT and linker (5’-GGGAGTTCCGGTGGTGGCGGGAGCGGAGGTGGAGGCTCGAGCGGT-3’) inserted into the HaloTag-removed-pFC15A vector (Promega). GPCR sequences were obtained from PRESTO-tango kit (Addgene Kit #1000000068) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA were synthesized from RNA (4 μg) using AMV Reverse Transcriptase (Promega). ...
-
bioRxiv - Immunology 2021Quote: CTLA-4 Blockade Bioassay was purchased from Promega (JA3001; Madison, WI, USA) and performed according to the manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2019Quote: ... during 4 h then with trypsin (Sequencing Grade Modified, Promega, Madison, WI) overnight ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1.6 μg DNA and 4 μl FuGENE HD transfection reagent (Promega, E231A) was used for 6-well format transfection according to the manual ...
-
bioRxiv - Genetics 2019Quote: ... after reducing SDS-PAGE on a gradient (4-15%) polyacrylamide gel (Promega) and transfer onto nitrocellulose membrane ...
-
bioRxiv - Systems Biology 2020Quote: ... initially for 4 hours with 1.5 μl trypsin (0.5 μg/μl; Promega) and then another 1-2 hours with 0.5 μl additional trypsin ...
-
bioRxiv - Neuroscience 2023Quote: ... to an agar block (4% agarose, low melting point, analytical grade, Promega, Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were digested with 4 ug Trypsin/Lys-C mix (Promega V5073) for 3-4 hrs at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 µL furimazine (0.36% vol/ vol diluted in BRET assay buffer, Promega) was added before readout on ClarioStar.
-
bioRxiv - Cell Biology 2023Quote: ... After addition of 4 μl of RNAsin Plus ribonuclease inhibitor (Promega N2611), the samples were spun down ...
-
bioRxiv - Bioengineering 2023Quote: ... 5 µL reactions were made by adding 4 µL LgBiT (Promega, N1120), 0.5 µL 100 µM p86-R4 (Vivitide ...
-
bioRxiv - Systems Biology 2023Quote: ... initially for 4 hours with 1.5 μl trypsin (0.5 μg/μl; Promega) and then another 1–2 hours with 0.5 μl additional trypsin ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were then digested with 4 μg of Trypsin/lys-C (Promega) overnight at 37°C before being collected by centrifugation with washes of 100mM Tetraethylammonium bromide ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM dNTP mix and RNasin Ribonuclease Inhibitors (Promega). This mixture was incubated at 25 °C for 10 min ...
-
bioRxiv - Cell Biology 2019Quote: ... alkylated and digested with 2 μg of Trypsin (Promega) overnight at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were digested with 2 μg Trypsin (Promega V5280) for 20 hrs at 37°C ...
-
bioRxiv - Bioengineering 2020Quote: ... and 2 U/μL RNasin Plus RNase Inhibitor (Promega). We performed DNase digestion at 37 °C for 1 hour followed by a 95 °C inactivation for 5 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... 2% (w/v) bisacrylamide (0.05% final concentration; V3141, Promega), 10× phosphate buffer saline (PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... 2) an RNAse inhibitor (1µL/mL of RNasin - Promega) was added to all the solutions after the fixation/permeabilization step ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 μL T7 Express Enzyme Mix (Promega, P1320) and incubated at 37 °C for 4 hours unless otherwise indicated ...
-
bioRxiv - Biophysics 2022Quote: ... and then digested with 2 μg of trypsin (Promega) overnight at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 μg Sequencing Grade Modified Trypsin (Promega, Madison, WI) was added to each sample and digested overnight at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... comprised of 2% (v/v) of GloSensor reagent (Promega, #E1290 ...
-
bioRxiv - Genomics 2020Quote: ... 2 mL of Wizard DNA Clean-Up resin (Promega) was added to the solution and mixed by inversion for two minutes ...
-
bioRxiv - Biophysics 2020Quote: ... 2 x GoTaq®qPCR Master Mix (Promega, Switzerland) and 1 μl cDNA ...
-
bioRxiv - Neuroscience 2022Quote: ... the sample was digested with trypsin (2 μg, Promega) in 50 mM ammonium bicarbonate (100 μl ...
-
bioRxiv - Microbiology 2024Quote: ... (2) addition of 600μL of Nuclei Lysis Buffer (Promega), and (3 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 50 mM TEAB and 2 µg LysC+trypsin (Promega) were added ...
-
bioRxiv - Cancer Biology 2023Quote: ... (2) DNA template degradation by the DNaseI free (Promega), and (3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using 2 µl of Fugene HD transfection reagent (Promega). The control reporter plasmid was transfected in parallel in equimolar amounts with pEGFP or pPRKRA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 2 μL of 20-fold diluted furimazine stock (Promega) in live cell substrate (LCS ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2 μL of CellTiter-Glo reagent (Promega, cat # G9683) was dispensed to each microplate well via BioRAPTR FRD ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 μL of ONE-glo luciferase detection reagent (Promega) was dispensed per well and luminance signal recorded with an Envision plate reader (Perkin Elmer).
-
bioRxiv - Microbiology 2024Quote: ... 2 μl of Nano-Glo Luciferase Assay Reagent (Promega) and 18 μl ddH2O were added to induce luminescence development ...
-
bioRxiv - Biophysics 2020Quote: CosM6 cells were transfected with ∼1 µg of wild type or mutant constructs using FuGENE6 (Promega) and were patched within 1-2 days after transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized from 1 μg of each RNA sample using Oligo(dT)15 Primer (Promega) and M-MLV Reverse Transcriptase (RNase H Minus ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µL cDNA was used as template for 25 cycles of PCR using GoTaq polymerase (Promega) targeting the TMV replicase using forward primer 5’ CCGCGAATCTTATGTGGAAT 3’ and reverse primer 5’ TCCTCCAAGTGTTCCCAATC 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... A 1:10 solution of sample homogenate to colentrazine was analyzed on a GloMax Explorer (Promega).
-
bioRxiv - Neuroscience 2022Quote: ... using 0.5 - 1 μg of cDNA and FuGene as per the manufacturer’s instructions (Promega, Madison, WI). Cells were fixed for immunocytochemistry 24 or 48 h after transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1.33 μL 1 M Tris-HCL pH 8.5 and 7.8 μL 0.5 mg/mL trypsin (Promega) were added and proteins left to digest for 16 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were diluted with 875uL of 50mM Tris buffer along with Trypsin (1:100, Promega #V511C) for overnight digestion ...
-
bioRxiv - Molecular Biology 2021Quote: Primary antibodies and the dilutions used are as follows: anti-Halo (mouse, Promega G9211, 1:200); anti-Ezh2 (mouse ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 0 or 1 μg Sequencing Grade Modified Trypsin (0 or 10 μl; #V5111, Promega, WI, USA) that was reconstituted within trypsin re-suspension buffer (50 mM acetic acid ...
-
bioRxiv - Biochemistry 2019Quote: ... the sample was digested overnight at 37 °C with trypsin (1:200 w:w; Promega, Madison, WI). Peptides were desalted using a Sep-Pak (Waters ...
-
bioRxiv - Cell Biology 2019Quote: The primary antibody was incubated in 1× PBST (PBS + 0.1% Triton X-100) + 0.2% BSA (Promega) overnight at 4°C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Total DNA was isolated from 1 ml culture using the Wizard Genomic DNA Purification Kit (Promega). Concentration and quality of the extracted DNA was assessed using the NanoDrop™ (Thermo Fisher Scientific ...