Labshake search
Citations for Promega :
2251 - 2300 of 3351 citations for 7H Pyrrolo 2 3 d pyrimidine 7 3 5 bis O 2 4 dichlorophenyl methyl 2 C methyl b D ribofuranosyl 4 chloro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of HiBiT lytic reagent (Promega N3040 ...
-
bioRxiv - Systems Biology 2023Quote: ... and 5 μg/mL Trypsin (Promega:487603)) for 1 hour at 25°C on a shaker (1000 rpm) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL of ADP Glo Reagent (Promega), supplemented with 0.01% Triton X-100 ...
-
bioRxiv - Genetics 2023Quote: ... and 5 μl of TransFast (Promega; E2431) in a serum-containing medium in a total volume of 500 μl and plated into one well of a 24-well plate ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of 2x GoTaq (Promega, #A600A), 0,4 µL forward primer (0,5 µM) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM UDP-glucose (UDP-Glc, Promega), 20 mM MgCl2 and 30 mΜ cyclic-di-GMP (Sigma) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Molecular Biology 2020Quote: ... 500-ng of Trypsin/Lys-C Mix (Promega Cat#V5072) was added and allowed to digest overnight for ∼18-hr at 37°C ...
-
bioRxiv - Genomics 2021Quote: ... Digestion was performed overnight at 37°C with trypsin (Promega V5113 ...
-
bioRxiv - Plant Biology 2020Quote: ... in 50 mM NH4HCO3 or Glu-C (sequencing grade, Promega) in 50 mM Tris/PO4 ...
-
bioRxiv - Cell Biology 2020Quote: ... Digestion was performed using mass spectrometry grade Lys-C (Promega) at a protein:Lys-C ratio of 100:1 (w/w ...
-
bioRxiv - Biochemistry 2022Quote: ... 50 mM Tris pH 8 overnight at 37 °C (Promega) at an estimated protein:enzyme ratio 1:100 ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were digested overnight at 37 °C with trypsin (Promega) with an enzyme ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 mM CaCl2 and 500 ng Trypsin Lys-C (Promega). On bead digest was carried out overnight at 37°C while shaking at 200 rpm ...
-
bioRxiv - Cancer Biology 2022Quote: ... and digested 16 hours at 37°C with trypsin (Promega) and stopped by addition formic acid (FA ...
-
bioRxiv - Biochemistry 2022Quote: ... the proteins were digested by Trypsin/Lys-C Mix (Promega). After the digestion ...
-
bioRxiv - Molecular Biology 2022Quote: ... firstly with Endoproteinase Lys-C (ratio 1:33 enzyme:lysate) (Promega) for 1 hour at room temperature then with trypsin (ratio 1:33 enzyme:lysate ...
-
bioRxiv - Neuroscience 2023Quote: ... In-gel digestion with Trypsin/Lys-C Mix solution (Promega) was performed as previously described (Gonzalez-Lozano & Koopmans ...
-
bioRxiv - Neuroscience 2022Quote: ... 100 µL of 0.1 µg/µL Trypsin/rLys-C (Promega) in 100 mM ammonium bicarbonate (pH 8 ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins were then incubated with Lys-C/trypsin mixture (Promega) (200 ng for pull-down samples and 1 ug for total lysate samples ...
-
bioRxiv - Biochemistry 2024Quote: ... and Glu-C (V1651) were obtained from Promega (Finnboda, Sweden).
-
bioRxiv - Cell Biology 2023Quote: ... Sequencing-grade porcine trypsin/Lys-C mix (Promega, Madison, WI) was added ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were digested overnight at 25L°C with trypsin (Promega) with an enzyme/substrate ratio of 1:250 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then sequencing-grade endopeptidase Trypsin/Lys-C Mix (Promega) was added at an enzyme–substrate ratio of 1:50 wt/wt ...
-
bioRxiv - Physiology 2023Quote: ... and digested (0.4 ug of Lys-C/Trypsin mix, Promega). After 4 hours of digestion in the urea buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were digested overnight at 37°C with trypsin (Promega) and Lys-C (Wako,125-05061 ...
-
bioRxiv - Neuroscience 2023Quote: ... Equilibrated cells were transfected with 0.8 μg of 5-HT1eR or 5-HT1FR and 8 μg of GloSensor plasmid (Promega), after mixing with 17.6 μl of PEI in OptiMEM (Gibco) ...
-
bioRxiv - Genetics 2019Quote: ... and digestion were performed by dithiothreitol (DTT, 10mM, 30min at room temperature), iodoacetamide (IAA, 10mM, dark for 30min at 37°C) and trypsin (MS Grade, Promega, 12.5ng/ul, 37°C overnight) sequentially before analyzing by Thermo Scientific™ Orbitrap Fusion™ Tribrid™ Mass Spectrometer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 30 min at 60°C) an alkylation (IAA 0.5 M, 30 min RT) proteins were digested using trypsin (Gold, Promega, 1ug / sample, overnight at 37°C). For LC MSMS analysis ...
-
bioRxiv - Pathology 2021Quote: ... The DNA-A and DNA-B fragments were purified and cloned into the pGEM-T Easy vector (Promega, Madison, WI, USA) and then transformed into Escherichia coli strain DH5α cells by the heat shock method ...
-
bioRxiv - Immunology 2021Quote: MSCs and B cells proliferation were measured using the CellTiter 96® AQueous cell proliferation assay kit from Promega (Madison, WI) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 mM Tris-HCl (pH 7), 1% Triton X-100, 1% NaDOC, 100 μg/mL cycloheximide (Applichem, Germany) and 30 U/mL RNase Inhibitor (Promega, United States)] ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were collected 24 hours after transfection and mixed with equal volume of Nano-Glo® Luciferase Assay reagent and the relative luminescence (RLU) was measured after 7 minutes using GloMax® 20/20 Luminometer (Promega). The identical cell lysate was then used for protein concentration determination using Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... and viability of the spheroids was determined after 7 days of treatment with the CellTiter-Glo® 3D Cell Viability Assay (Promega G9682) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 µl of the RNA from input and supernatant and 7 µl of the pre-eluates and eluates were digested with RQ1 DNase I (Promega, Walldorf, Germany) and cDNA synthesis was carried out with Superscript IV reverse transcriptase (Thermo Fischer ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted by the addition of 7 volumes of 25 mM Tris-HCl pH 8.0 and sequencing-grade modified Trypsin (Promega Corp., Madison, WI) was added (0.4 μg/ sample ...
-
bioRxiv - Cancer Biology 2024Quote: ... The drug and media were refreshed on day 3 and cell viability was assessed in the cell lines as compared with the vehicle condition (0.1% DMSO) at 7 days post treatment using MTS reagent (Promega, Madison, WI, USA). IC50 values were determined in the cell lines by dose-response curves calculated using the drc (v3.0.1 ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 μL of 5× Green GoTaq® Flexi Buffer and 0.25 μL of 5U GoTaq® DNA Polymerase (Promega, USA) in a total volume of 25 μL ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... 30 min at 60°C) an alkylation (IAA 0.5M, 30 min RT) microtubule-associated protein enriched fractions were digested using trypsin (Gold, Promega, 1 μg / sample, overnight at 30°C). Peptide clean-up was done using OMIX C18 (Agilent ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 µg/ml RNAsin (Promega, Cat#: N2511). The cells were collected through scraping and homogenised by pipetting ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 ng/μl of sequencing-grad trypsin (Promega) was added and proteins digested overnight at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL/mL RNasin Plus (Promega, cat. #N2611) was added 10 minutes before use ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 ng of Renilla luciferase report (Promega) were co-transfected into U87 human primary glioblastma cells by using ESCORT V transfection reagent (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 ng of pGL4.53(luc2/PGK) vector (Promega), 1 ng of pNL plasmid ...