Labshake search
Citations for Promega :
2101 - 2150 of 3229 citations for 7 Hydroxy 4 methoxy 1 indanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... PD-L1 neutralization was done in a PD-1/PD-L1 Blockade Bioassay (J1250, Promega).
-
bioRxiv - Cell Biology 2022Quote: ... or secondary antibodies: anti-mouse IgG horseradish peroxidase (HRP) (Promega, Madison, WI, W402B, 1:10,000), anti-rabbit IgG HRP (Promega ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1 µl of crude DNA lysate was used with 2x GoTaq Reaction Mix (Promega M7123) supplemented with 5% DMSO.
-
bioRxiv - Immunology 2022Quote: ... 24 h following stimulation with IFN cells were harvested in 1 × passive lysis buffer (Promega) and stored at −20°C ...
-
bioRxiv - Microbiology 2023Quote: Viral loads were quantified using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-COV-2 the nCOV_N1 primer/probe mix from the SARS-CoV-2 (2019-nCoV ...
-
bioRxiv - Biophysics 2023Quote: ... Cross-linked samples for XL-MS were digested by 1:50 (m/m) trypsin (Promega) overnight at 37 °C while shaking at 600 rpm ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA (1 μg per reaction) was reverse transcribed using the GoScript Reverse Transcription System (Promega). Following reverse transcription ...
-
bioRxiv - Immunology 2023Quote: ... Complementary DNA (cDNA) was generated using 1 μg RNA using M-MLV Reverse Transcriptase (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were digested overnight at 37° C with 1 μg mass spectrometry grade Trypsin (Promega). The resulting peptide sample was acidified with 10% formic acid and 10% trifluoroacetic acid (TFA ...
-
bioRxiv - Cell Biology 2024Quote: ... and samples were digested with 1:15 mass ratio of Sequencing Grade Modified Trypsin (Promega) using an S-trap mini device (Protifi ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then placed in a 50 mL solution of 1 ×Diamond Nucleic Acid Dye (Promega) in 0.2 ×TBE buffer pH 7.6 to rock in the dark for 30 min ...
-
bioRxiv - Biochemistry 2024Quote: ... Trypsin was added at a 1:20 enzyme-to-ribosome ratio (2.5 µg; Promega, V5111) following incubation ON ...
-
bioRxiv - Microbiology 2024Quote: ... The membranes were incubated with HRP-conjugated goat anti-rabbit IgG (1:8000; Promega, USA) as the secondary antibody ...
-
bioRxiv - Biochemistry 2024Quote: ... pH 8.0) containing 2 nM 11S and 1/250 Nano-Glo Luciferase Assay Reagent (Promega) was added to the cells and background luminescence read for 5 min ...
-
bioRxiv - Biochemistry 2024Quote: ... Trypsin digestion was performed with a 1 μg /μL trypsin solution (Trypsin Gold, V528A, Promega) at a ratio of 1:50 at 37 °C for 16 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... Ten ml of conditioned media was treated with 1 ml Proteinase K (Promega Cat # V3021) in buffer (10 mM Tris-Cl pH8.0 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 25 µL digestion buffer was added (1 µg sequencing grade modified trypsin (Promega, V511A) in 50 mM TEAB) ...
-
bioRxiv - Bioengineering 2024Quote: ... A complex of 1 μg of plasmid was mixed with 3 μl of Viafect (Promega) in OPTI-MEM and mixed and incubated at room temperature for 20 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were digested with trypsin (1/100, w/w, Sequencing Grade Modified Trypsin, Porcine; Promega) overnight ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 μM of FabH (Human Kappa) was immobilized on 200 μl SA magnetic beads (Promega) and incubated with 1 mL phage library for 1 hour at room temperature with gentle shaking ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by secondary antibody diluted 1: 2500 in blocking solution (HRP-conjugated anti-Rabbit, Promega). Chemiluminescence was revealed with ECL Clarity (BioRad ...
-
bioRxiv - Biochemistry 2024Quote: ... and the proteins were digested overnight at 37°C using 100:1 protein:trypsin ratio (Promega). After digestion ...
-
bioRxiv - Bioengineering 2024Quote: ... with the luciferin conjugated specific CYP3A (1:40) substrate (P450 P-Glo Luminescence Kit, Promega) at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... The secondary antibodies used were anti-mouse IgG-HRP (cat #W4028, Promega, 1:10000 dilution), anti-rabbit IgG-HRP (cat#W4018 ...
-
bioRxiv - Cell Biology 2024Quote: ... resuspended in Hank’s buffered salt solution (HBSS) containing NanoGlo Live Cell Reagent (1:20; Promega) with furimazine ...
-
bioRxiv - Cancer Biology 2024Quote: ... The samples were then digested with trypsin at a ratio of 1:50 (Promega #V5111) over night at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... The sample was digested overnight with 2.5 µl of 1 µg/µl trypsin (Promega V528A) at 37°C ...
-
bioRxiv - Biophysics 2020Quote: CosM6 cells were transfected with ∼1 µg of wild type or mutant constructs using FuGENE6 (Promega) and were patched within 1-2 days after transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized from 1 μg of each RNA sample using Oligo(dT)15 Primer (Promega) and M-MLV Reverse Transcriptase (RNase H Minus ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µL cDNA was used as template for 25 cycles of PCR using GoTaq polymerase (Promega) targeting the TMV replicase using forward primer 5’ CCGCGAATCTTATGTGGAAT 3’ and reverse primer 5’ TCCTCCAAGTGTTCCCAATC 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... A 1:10 solution of sample homogenate to colentrazine was analyzed on a GloMax Explorer (Promega).
-
bioRxiv - Neuroscience 2022Quote: ... using 0.5 - 1 μg of cDNA and FuGene as per the manufacturer’s instructions (Promega, Madison, WI). Cells were fixed for immunocytochemistry 24 or 48 h after transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1.33 μL 1 M Tris-HCL pH 8.5 and 7.8 μL 0.5 mg/mL trypsin (Promega) were added and proteins left to digest for 16 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were diluted with 875uL of 50mM Tris buffer along with Trypsin (1:100, Promega #V511C) for overnight digestion ...
-
bioRxiv - Molecular Biology 2021Quote: Primary antibodies and the dilutions used are as follows: anti-Halo (mouse, Promega G9211, 1:200); anti-Ezh2 (mouse ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 0 or 1 μg Sequencing Grade Modified Trypsin (0 or 10 μl; #V5111, Promega, WI, USA) that was reconstituted within trypsin re-suspension buffer (50 mM acetic acid ...
-
bioRxiv - Pathology 2020Quote: ... The extracted RNA (1 μg) was reverse-transcribed using Reverse Transcription System (Promega, Madison, Wisconsin, USA), and cDNAs were amplified using GeneAmp PCR System 9700 (Applied Biosystems ...
-
bioRxiv - Genetics 2021Quote: ... from the 1% TAE agarose gel and cloned into the pGEM-T Easy Vector System (Promega) for transformation ...
-
bioRxiv - Biochemistry 2021Quote: ... the membrane was imaged using 500 µl of 1:1000 NanoGlo substrate (Promega, catalogue number: N1120) diluted in 10 mM sodium phosphate buffer pH 7.0.
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were digested by incubation with sequencing-grade modified trypsin (1/50 w/w; Promega, V5113) for 12 h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... One hundred nanograms of genomic DNA spiked with 1% (w/w) of unmethylated lambda DNA (Promega) was used for the library preparation ...
-
bioRxiv - Bioengineering 2021Quote: ... RNA (1 μg) was subjected to RT-PCR in accordance with the protocol provided by Promega. The transcripts were quantitated and normalized to the internal GAPDH control ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples were digested overnight at 37°C with 1 μg trypsin (sequencing grade; #V5111, Promega) per 100 μg of protein.
-
bioRxiv - Microbiology 2020Quote: ... The cells were then lysed with 40 μL of 1× Cell Culture Lysis Reagent (Promega, E153A) for 40 minutes with shaking at 500 rpm ...
-
bioRxiv - Molecular Biology 2020Quote: ... at a 1:1000 dilution and a secondary antibody against rabbit coupled to HRP (Promega W4011) at a 1:20 000 dilution.
-
bioRxiv - Microbiology 2020Quote: ... cells were washed once with PBS and lysed in 40μl of 1 x CCLR buffer (Promega) for 10 min on a rocking plate at RT ...
-
bioRxiv - Microbiology 2021Quote: ... The infected cells were collected and lysed with 100 μl of 1× passive lysis buffer (Promega). The samples were sonicated for 30 seconds before centrifugation and 5 μl of the supernatants were collected for luciferase expression reading by the dual-luciferase reporter assay system (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 µg of RNA was used to create cDNA with the ImpromII Reverse Transcriptase Kit (Promega) following the manufactures standard protocol including oligodT oligos and 4.8 M MgCl2 in each 20 µl reaction (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... Promega standard protocol was used to synthesise cDNA from 1 μg RNA (Promega, Madison, Wisconsin, USA). Cripto ...
-
bioRxiv - Cell Biology 2021Quote: ... USA] and enzymatically proteolysed using trypsin/LysC (1:25 enzyme:protein ratio; V5072, Promega, Madison, WI, USA). Peptides from each sample were labelled using the ten-plex TMT reagent kit (90110 ...