Labshake search
Citations for Promega :
2101 - 2150 of 3879 citations for 6 Bromo 2 trifluoromethylimidazo 1 2 a pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... For trypsin digestion 1 μg of trypsin (V5111; Promega) was added ...
-
bioRxiv - Neuroscience 2024Quote: ... then digested with trypsin (Promega, 1:50 w/w) overnight at 37ºC ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 unit of Taq polymerase (Promega, Madison, WI, USA), and approximately 75 ng of schistosome genomic DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... then with trypsin (Promega, 1:50 (protease to protein)) for 6 hours on a 37 °C shaker.
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl of 4 mg/ml RNase A (Promega) was added and the sample incubated for 30 min at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 U/µL Rnasin® Plus RNAse inhibitor (Promega), 2 mM DTT ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mM CaCl2 and sequencing grade trypsin (Promega, WI) was added to all protein samples at a 1:50 (w/w ...
-
bioRxiv - Microbiology 2023Quote: ... and the addition of 1:1000 Nano-Glo (Promega). The bioluminescent signal was measured using a CLARIOstar luminometer (BMG Labtech ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg of RNA treated with DNase (RQ1, Promega) was reverse-transcribed by Superscript III (Life Technologies) ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse Anti-β-Galactosidase (#Z3781, 1:200) from Promega; rabbit anti-SWS (1:1000 from Doris Kretzschmar) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and mouse anti-β-galactosidase (Promega #Z378, 1:1000) or rabbit anti-mCherry (BioVision ...
-
bioRxiv - Molecular Biology 2023Quote: ... and anti- mouse IgG antibody (1:1,000, #S3721, Promega).
-
bioRxiv - Microbiology 2023Quote: ... which were digested with 1 µg Lys-C (Promega) overnight at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... then with trypsin (Promega; 1:50, 37°C overnight). Samples were purified by solid-phase extraction (SepPak tC18 cartidges ...
-
bioRxiv - Neuroscience 2023Quote: ... and goat anti-mouse IgG (1:5,000; W4011, Promega) antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-p-JNK (pTPpY, Promega, USA-1:100 dilution); 8 ...
-
bioRxiv - Microbiology 2023Quote: ... using SYBR Green GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Bioengineering 2023Quote: ... 1 μL random primers (50 ng/μL, Promega, C1181), 2 μL 0.1 M DTT ...
-
bioRxiv - Systems Biology 2024Quote: ... Then 1 µg of sequencing grade modified trypsin (Promega) was added to the samples and incubated for 16 h at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mg/mL Proteinase K (Promega Corporation, WI, USA) with 0.5% SDS in PBS at 40 °C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of HaloTag TMR ligand (Promega, 5 mM) was added to 100 µL of JetABC (2.5 µM d-o-p ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µg ml-1 Sequencing Grade Modified Trypsin (Promega). Peptides were eluted with 50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Immunology 2023Quote: ... in a 1.5:1 ratio with FuGene (#E2311, Promega). One day post transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were dyed with 1 – 10 pM JF549 (Promega) and 50 nM Hoechst 33342 for an hour ...
-
bioRxiv - Neuroscience 2024Quote: ... then digested with trypsin (Promega, 1:50 w/w) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 µL of HiBit buffer (LgBit 1:200, Promega, N112A ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-GFAP (1:1000; Promega, Cat. No. G560A), rabbit anti-GPX4 (1:1000 ...
-
bioRxiv - Immunology 2024Quote: ... and RNasin® Ribonuclease Inhibitor (#N2615, Promega; 1:1000)) ...
-
bioRxiv - Microbiology 2024Quote: ... leaves were sprayed with 1□mM luciferin (Promega, E1603) and 0.02 % (v/v ...
-
bioRxiv - Systems Biology 2020Quote: ... TFE was then diluted to 25% with 50mM ABC, LysC (Wako Chemicals, 1:100 lysC:protein ratio) and sequencing-grade modified trypsin (Promega, 1:50 trypsin:protein ratio) was added and incubated overnight at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... TFE was then diluted to 25% with 50 mM ABC, LysC (Wako Chemicals, 1:100 lysC:protein ratio) and sequencing-grade modified trypsin (Promega, 1:50 trypsin:protein ratio) was added and incubated overnight at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... protein digestion was performed by 1 µg of Lys-C (Wako) at 37 °C for 3 h following 1 µg of trypsin (Promega, Madison, WI, USA) at 37 °C for 16 h ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were then diluted to a final guanidine chloride concentration of 1 M with 100 mM ammonium bicarbonate and digested with sequencing grade porcine trypsin (Promega, 1:100 trypsin:protein) for 22 h at 37° C ...
-
bioRxiv - Immunology 2020Quote: Activity of the inflammatory caspases 1/4/5 was measured using a commercially available Caspase-Glo® 1 Inflammasome Assay (Promega, WI, USA) from HFFs seeded in 96-well plates (2×104 cells per well) ...
-
bioRxiv - Molecular Biology 2023Quote: ... or stimulated for 10 minutes or 1 hour by BRET through activation of NanoLuc’s bioluminescence with its substrate furimazine (1:100 dilution of Promega nano-Glo Live Assay). After treatment ...
-
bioRxiv - Cell Biology 2023Quote: ... a master mix was prepared by diluting the Extracellular NanoLuc Inhibitor at a 1:1000 ratio and the NanoBRET Nano-Glo Substrate at a 1:333 ratio in PBS (Promega, Madison, WI, USA). Aliquots of the Nluc substrate/inhibitor master mix (100 µl ...
-
bioRxiv - Immunology 2023Quote: ... prepared by combining ONE-Glo™ EX Luciferase Assay Buffer with ONE-Glo™ EX Luciferase Assay Substrate in 1:1 ratio (Promega, USA). After measuring the signal of the Firefly luciferase in the GloMax® 20/20 Luminometer (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μg of pPAX packaging vector and 1 μg of VSV-G envelope vector using FuGENE® HD Transfection Reagent (Promega, cat.no. E2311), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and digested with Lys-C (1/200 weight of protein; Fujifilm Wako) and sequencing grade modified trypsin (1/100 weight of protein; Promega, Madison, WI, USA) at 37 °C overnight in 0.1 % Rapigest ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by a second dilution step to ~1 M urea with 50 mM NH4HCO3 and addition of trypsin (Promega, 1:50, 37 °C, overnight). After overnight incubation ...
-
bioRxiv - Immunology 2022Quote: ... and digested over-night with Lys-C-Trypsin mix (1:100 enzyme to protein ratio) and trypsin (Promega; 1:50 enzyme to protein ratio). Following the digestion step ...
-
bioRxiv - Cell Biology 2020Quote: ... rabbit and mouse anti-βgal 1:500 (Cappel, Promega, Abcam), mouse anti acetylated tubulin 1:100 (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... and cleaned from excess DNA with DNAse 1 enzyme (Promega). RNA samples were reverse transcribed to cDNA and an anchor sequence at the variable part of the TCR was added using single strand ligation ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The reaction contained 1 unit of GoTaq DNA polymerase (Promega), 1X enzyme Flexi Buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... from Santa Cruz Biotechnology, mouse anti-β-Galactosidase (Z378A, 1:500) from Promega, mouse anti-MYC tag (#2276 ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μg total RNA and 0.5 μg random primers (Promega) were used with the GoScript™ Reverse transcriptase (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μg total RNA and 0.5 μg random primers (Promega) were used with the GoScript Reverse transcriptase (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... or goat anti-rabbit IgG at 1:3000 (Promega W4011). Washes were with high-salt TBST (50 mM Tris pH 7.5 400 mM NaCl 0.1% Tween-20).
-
bioRxiv - Microbiology 2022Quote: ... 1 μg total RNA and 0.5 μg random primers (Promega) were used with the GoScript™ Reverse transcriptase (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μL 3.5 mM Alexa Fluor 660 HaloTag ligand (Promega) was added to 200-300 μL cells and incubated at 30°C for 5 minutes ...