Labshake search
Citations for Promega :
2051 - 2100 of 3249 citations for 6H Purin 6 imine 1 ethoxy 7 ethyl 1 7 dihydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Fresh bacmid DNA was transfected into Sf9 cells at 0.5×106 cells/mL in 6-well cell culture plates using FuGene HD (Promega) according to the manufacturer’s protocol (final concentration 10 μg/mL) ...
-
bioRxiv - Cell Biology 2021Quote: HeLa cells were transfected with WT or mutant C10 constructs using the FuGENE 6 transfection reagent (Promega, cat# PRE2691). The cells were incubated at 37 C at least overnight before downstream analysis.
-
bioRxiv - Neuroscience 2020Quote: ... and 0.4 pmol/well of hairpin constructs (pscAAV-GFP-shFoxP1 or shCtrl) using FuGENE 6 Transfection Reagent (#E2691, Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Vero E6 cells (1.2 x 106 cells/well, 6-well format) after 24 hpi using passive lysis buffer (Promega) based on the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were transfected with 2 μg of FLAG-tagged β2 or β1 adrenergic receptor DNA using Fugene 6 (Promega) and seeded at a density of ∼70,000 cells.ml−1 on 18 mm glass coverslips 4-8 hours after transfection.
-
bioRxiv - Cancer Biology 2020Quote: Viral particles were packaged in HEK293T cells seeded at a density of 1.5×106/10cm petri dishes in a proportion of 24μL Fugene 6 (Promega, E2691) in 136μL serum-reduced OPTI-MEM (Gibco ...
-
bioRxiv - Microbiology 2020Quote: Env-pseudotyped luciferase reporter viruses were generated by co-transfection of 810 ng of an env expression vector and 810 ng of pZM247Fv2Δenv backbone (22) using 293T cells and the Fugene 6 reagent and protocol (Promega). Five hours after transfection ...
-
bioRxiv - Genetics 2019Quote: ... genes were isolated from C57BL/6 mouse genomic DNA by standard PCR and inserted into the pGL4.10 vector (Promega).
-
bioRxiv - Neuroscience 2021Quote: ... The constructs (1.2 µg) were cotransfected with vesicular stomatitis virus G (600 ng) and pSPAX2 (800 ng) using FuGENE 6 (Promega). The lentiviral supernatants were collected 2 days after transfection ...
-
bioRxiv - Developmental Biology 2020Quote: ... C2C12 myoblasts were seeded at 20-30% confluence in 10cm format (CELLSTAR) and forward-transfection with Fugene-6 (Promega) according to manufacturer’s protocol with the following plasmids ...
-
bioRxiv - Biochemistry 2022Quote: ... the D10ACas9 nickase and the HDR template on 6-well plates at 70% confluency using FuGene® HD (Promega). Cells were allowed to recover for 7-10 days (splitting if necessary ...
-
bioRxiv - Biochemistry 2022Quote: ... and penicillin (100 U/ml)/ streptomycin (100 μg/ml) (complete media) then transfected with Fugene 6 (Promega, Madison, WI). Cells were then lysed 2 days post-transfection using a lysis buffer containing 150 mM NaCl ...
-
bioRxiv - Developmental Biology 2022Quote: ... into a 10 cm plate of HEK293T cells at 60-70% using Fugene 6 transfection reagent (Promega, Cat #E2691). Media containing lentiviral particles were collected at 24 ...
-
bioRxiv - Cell Biology 2022Quote: ... pX459-derived plasmids encoding both Cas9 and the gRNA were transfected using Fugene 6 (cat. no. E2692 from Promega). 24 h post-transfection puromycin was used to select for transfected cells ...
-
bioRxiv - Cell Biology 2022Quote: ... were transfected with 2 μg of fresh bacmid DNA and 6 μL of FuGene HD transfection reagent (Promega, E2311) according to the manufacture’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... fresh bacmid DNA was transfected into Sf9 cells at 0.5×106 cells/mL in 6-well cell culture plates using FuGene HD (Promega) according to the manufacturer’s protocol (final concentration 10 μg/mL) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 500 ng of lenti-viral transfer plasmids previously described along with 3 µl of Fugene 6 (E2692, Promega) transfection reagent ...
-
bioRxiv - Neuroscience 2023Quote: ... We amplified the regions from C57Bl/6 tail snip DNA or from human male genomic DNA (Promega catalog # G1471) using FastPhusion 2x Master Mix (Thermo Fisher catalog # F548L) ...
-
bioRxiv - Microbiology 2023Quote: ... 6 μg of IMC was transfected into 293T cells in a T25 flask using the FuGENE6 transfection reagent (Promega). The cells were cultured at 37°C for 6 hours before the medium was replaced by fresh medium ...
-
bioRxiv - Microbiology 2023Quote: HFF or HEK293 cells (3 × 104 cells per well of a 24-well plate or 1 × 105 cells per well of a 6-well plate) were reverse transfected with 0.5 μg of pCW57-CMV-KDEL-mCherry-GF using Fugene HD (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Beads were washed 6 times with 50 mM ammonium bicarbonate and then treated with TPCK-treated modified trypsin (Promega) for 16 hours at 37°C on an end-over-end rotator ...
-
Loss of intermicrovillar adhesion impairs basolateral junctional complexes in transporting epitheliabioRxiv - Cell Biology 2024Quote: A validated CDHR2 KO CL4 cell clonal population was transfected with pHALO-N3-CDHR2 using FuGENE 6 (Promega #E2691) at a FuGENE:DNA (μL:μg ...
-
bioRxiv - Biophysics 2020Quote: CosM6 cells were transfected with ∼1 µg of wild type or mutant constructs using FuGENE6 (Promega) and were patched within 1-2 days after transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized from 1 μg of each RNA sample using Oligo(dT)15 Primer (Promega) and M-MLV Reverse Transcriptase (RNase H Minus ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µL cDNA was used as template for 25 cycles of PCR using GoTaq polymerase (Promega) targeting the TMV replicase using forward primer 5’ CCGCGAATCTTATGTGGAAT 3’ and reverse primer 5’ TCCTCCAAGTGTTCCCAATC 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... A 1:10 solution of sample homogenate to colentrazine was analyzed on a GloMax Explorer (Promega).
-
bioRxiv - Neuroscience 2022Quote: ... using 0.5 - 1 μg of cDNA and FuGene as per the manufacturer’s instructions (Promega, Madison, WI). Cells were fixed for immunocytochemistry 24 or 48 h after transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1.33 μL 1 M Tris-HCL pH 8.5 and 7.8 μL 0.5 mg/mL trypsin (Promega) were added and proteins left to digest for 16 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were diluted with 875uL of 50mM Tris buffer along with Trypsin (1:100, Promega #V511C) for overnight digestion ...
-
bioRxiv - Molecular Biology 2021Quote: Primary antibodies and the dilutions used are as follows: anti-Halo (mouse, Promega G9211, 1:200); anti-Ezh2 (mouse ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 0 or 1 μg Sequencing Grade Modified Trypsin (0 or 10 μl; #V5111, Promega, WI, USA) that was reconstituted within trypsin re-suspension buffer (50 mM acetic acid ...
-
bioRxiv - Biochemistry 2019Quote: ... the sample was digested overnight at 37 °C with trypsin (1:200 w:w; Promega, Madison, WI). Peptides were desalted using a Sep-Pak (Waters ...
-
bioRxiv - Cell Biology 2019Quote: The primary antibody was incubated in 1× PBST (PBS + 0.1% Triton X-100) + 0.2% BSA (Promega) overnight at 4°C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Total DNA was isolated from 1 ml culture using the Wizard Genomic DNA Purification Kit (Promega). Concentration and quality of the extracted DNA was assessed using the NanoDrop™ (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNAs were diluted 1:5 and qPCR was performed using GoTaq® qPCR Master Mix (Promega). Primers for mCyb5r3 were ...
-
bioRxiv - Pathology 2020Quote: ... The extracted RNA (1 μg) was reverse-transcribed using Reverse Transcription System (Promega, Madison, Wisconsin, USA), and cDNAs were amplified using GeneAmp PCR System 9700 (Applied Biosystems ...
-
bioRxiv - Biochemistry 2019Quote: ... 20 μg of each sample was digested by adding 1 μg of sequencing grade trypsin (Promega) for 16 h at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... from the 1% TAE agarose gel and cloned into the pGEM-T Easy Vector System (Promega) for transformation ...
-
bioRxiv - Biochemistry 2021Quote: ... the membrane was imaged using 500 µl of 1:1000 NanoGlo substrate (Promega, catalogue number: N1120) diluted in 10 mM sodium phosphate buffer pH 7.0.
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were digested by incubation with sequencing-grade modified trypsin (1/50 w/w; Promega, V5113) for 12 h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... One hundred nanograms of genomic DNA spiked with 1% (w/w) of unmethylated lambda DNA (Promega) was used for the library preparation ...
-
bioRxiv - Bioengineering 2021Quote: ... RNA (1 μg) was subjected to RT-PCR in accordance with the protocol provided by Promega. The transcripts were quantitated and normalized to the internal GAPDH control ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples were digested overnight at 37°C with 1 μg trypsin (sequencing grade; #V5111, Promega) per 100 μg of protein.
-
bioRxiv - Microbiology 2020Quote: ... The cells were then lysed with 40 μL of 1× Cell Culture Lysis Reagent (Promega, E153A) for 40 minutes with shaking at 500 rpm ...
-
bioRxiv - Molecular Biology 2020Quote: ... at a 1:1000 dilution and a secondary antibody against rabbit coupled to HRP (Promega W4011) at a 1:20 000 dilution.
-
bioRxiv - Microbiology 2020Quote: ... cells were washed once with PBS and lysed in 40μl of 1 x CCLR buffer (Promega) for 10 min on a rocking plate at RT ...
-
bioRxiv - Microbiology 2021Quote: ... The infected cells were collected and lysed with 100 μl of 1× passive lysis buffer (Promega). The samples were sonicated for 30 seconds before centrifugation and 5 μl of the supernatants were collected for luciferase expression reading by the dual-luciferase reporter assay system (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 µg of RNA was used to create cDNA with the ImpromII Reverse Transcriptase Kit (Promega) following the manufactures standard protocol including oligodT oligos and 4.8 M MgCl2 in each 20 µl reaction (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... Promega standard protocol was used to synthesise cDNA from 1 μg RNA (Promega, Madison, Wisconsin, USA). Cripto ...
-
bioRxiv - Cell Biology 2021Quote: ... USA] and enzymatically proteolysed using trypsin/LysC (1:25 enzyme:protein ratio; V5072, Promega, Madison, WI, USA). Peptides from each sample were labelled using the ten-plex TMT reagent kit (90110 ...