Labshake search
Citations for Promega :
2051 - 2100 of 4460 citations for 5 1 3 Dioxolan 2 yl 2 3 fluorobenzoyl thiophene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The first-strand cDNA was synthesized from 5 µg of the total RNA with an oligo (dT) primer using the AMV reverse transcriptase (Promega). A polymerase chain reaction (PCR ...
-
bioRxiv - Microbiology 2022Quote: ... Huh7.5.1 cells were infected with MLB1 and MLB2 astroviruses (MOI 5) in the presence or absence of 20 µM z-VAD-fmk (pan-caspase inhibitor, Promega). At indicated time post infection ...
-
bioRxiv - Developmental Biology 2022Quote: ... Proteins were on-bead digested using 5 μl of Sequencing Grade Trypsin (100 ng/μl in 10 mM HCl, Promega). The digestion was carried out in a microwave instrument (Discover System ...
-
bioRxiv - Molecular Biology 2022Quote: ... from the EPO gene enhancer (sequence: tcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgttcgaagccctacgtgctgtctcacacagccttct gatctcgacctaccggccgttcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgt) into the 5’ of the minimal TATA-box promoter in the pGL4.23 [luc2/minP] vector (Promega #E841A). A control pHRL-TK vector (Promega #E2241 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Flies were placed individually in 100 ul Chelex solution (5g of Chelex mixed with 95ml TE buffer) with 5 ul proteinase K (Promega), and incubated overnight at 56°C ...
-
bioRxiv - Immunology 2022Quote: ... or HT1080/Ace2 cl14 cells (for all variant neutralization assays) for 48 hours after which cells were washed with PBS and lysedwith Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysateswas measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Kinase activity of phosphorylated CDK2 with cyclin A and varying amounts of inhibitor (dinaciclib or 5) were measured using the ADP-Glo Kinase Assay (Promega) in a luminescence plate reader (Tecan Infinite M1000 PRO) ...
-
bioRxiv - Neuroscience 2022Quote: ... Flag-tagged STAU1 or STAU1RBDΔ3 or Flag plasmids with the wildtype or mutant 5’UTR-MTOR-LUC or luciferase empty vector constructs and Renilla luciferase plasmid (pRL-SV40 vector, Promega) according to an experimental set-up ...
-
bioRxiv - Biochemistry 2023Quote: ... dehydrated with 0.2 mL of 100% acetonitrile and rehydrated with 5 μL of the digestion solution containing 15 μg/mL sequencing-grade trypsin (Promega) in 20 mM aqueous solution of NH4HCO3 ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with or without 50 μM adenosine 5′-triphosphate (ATP) at 30 °C for 30 minutes followed by kinase assays using ADP-Glo Kinase Assay kit (Promega). Data were analyzed using GraphPad Prism 9 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5×104 cells/well were seeded in 24-well plates and transfected with 10 ng pRL-CMV (Promega, Walldorf, Germany) together with either 250 ng pSuper8xTOPFlash or 250 ng pSuper8xFOPFlash [22] using the FuGENE6® reagent (Promega) ...
-
Disruption of the Aspergillus fumigatus RNA interference machinery alters the conidial transcriptomebioRxiv - Microbiology 2023Quote: ... Protein precipitates were resolubilized in 5% trifluoroethanol of aqueous 100 mM TEAB and digested for 18 h with Trypsin+LysC (Promega) at a ratio of 25:1 protein:protease ...
-
bioRxiv - Microbiology 2022Quote: ... cells were co-transfected with RIG-I-2CARD (5 ng) and lysed at 24 hours after transfection using Passive Lysis Buffer (Promega). Samples were processed and luciferase activity was measured using the Dual-Luciferase Assay System (Promega ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Plates were then incubated for 72 h at 37°C and 5% CO2 and cell viability determined by CellTiter-Glo Luminescent Cell Viability Assay (Promega). In short ...
-
bioRxiv - Cell Biology 2024Quote: 2-3 days before the recording the cultures were transferred into a recording medium containing 5% FBS and 0.1 mM luciferin (Promega E1601) (Feeney et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNAs were amplified with 6 PCR cycles using short Solexa P3/5 primers to allow beads-based size selection with ProNex Beads Size-selection Chemistry (Promega). In order to avoid over-amplification ...
-
bioRxiv - Cancer Biology 2024Quote: ... Each well was transfected with 500 ng pGL4.22 vector with or without H1-0 promoter expression as well as 5 ng Renilla luciferase control plasmid pGL4.73 (Promega, #E6911), and 250 ng of the respective pcDNA3.1 vectors (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Tris 50mM pH8.0 and samples were heated 5 min at 90°C before digestion in a mix of 500 ng of LysC (Promega) at 37°C for 2h ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the chromatin-associated fraction was sonicated on a Bioruptor (5 times 20 sec on/off intervals) prior to DNase treatment using RQ1 DNase (Promega) and RNA extraction using Trizol ...
-
bioRxiv - Microbiology 2024Quote: ... The 25 μl reaction contained 5 μl of PCR Green Buffer with magnesium chloride (Promega, Cat N° M7845, Madison, USA), 1 μl of 5 mM dNTP ...
-
bioRxiv - Microbiology 2024Quote: ... Purified DENV2 EDIII was biotinylated by incubating 100 µg of DENV2 EDIII with 5 nmol of the HaloTag PEG biotin ligand (Promega) at room temperature (RT ...
-
bioRxiv - Microbiology 2024Quote: ... Exponentially growing and stationary phase cells yielding a total OD600 of 800 were resuspended in 5 ml 1x FastBreak cell lysis buffer (Promega) for 30 minutes on ice and then sonicated afterwards ...
-
bioRxiv - Biophysics 2024Quote: ... Proteins were digested to peptides by adding 25 µL of 50 mM ammonium bicarbonate containing 5 µg of trypsin (Promega) and incubating at 37 °C for 18 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells in each well were resuspended in 30 μL of TLR7-Fc or other Fc-tagged proteins (final concentration 5 μg/mL) in 0.5% BSA in 1x DPBS containing 200U/mL RNasein (Promega, N2511), and incubated on ice for 45 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... samples were centrifuged at 200× g for 5 minutes and then analyzed with the Nano-Glo HiBiT Lytic Detection System (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The Renilla luciferase activity associated with WT or uORF-mutated 5’UTRs was measured according to the manual of the Dual-Luciferase Reporter Assay System (Promega) 32 h after transfection and was normalized to the activity of firefly luciferase.
-
bioRxiv - Cell Biology 2024Quote: ... a separate set of duplicate cell suspensions were measured at 475 nm excitation and 535 nm emission wavelengths after addition of 5 μM coelenterazine-h (Promega). PBS or 10 μM quinpirole was added to cell suspensions and BRET emissions were immediately measured again ...
-
bioRxiv - Cell Biology 2021Quote: ... psPAX2 and pMD2.G at the ratio of 1:1:1 in HEK293T cells using ProFection Mammalian Transfection System (Promega, E1200), medium was changed 16h post transfection and virus containing supernatant was harvested 48h later ...
-
bioRxiv - Biochemistry 2020Quote: ... three washes of 10 min in PBS-T were performed and membranes were incubated 1 hour at RT with the following 1:5000 or 1:2500 horseradish peroxidase conjugated secondary antibodies in 1% milk in PBS-T: anti-mouse (Promega, #W402B), anti-rabbit (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 1:2000 RealTime-Glo MT Cell Viability Assay Substrate (to visualise Nluc, first diluted 1:1 in DMSO, Promega G9711).
-
bioRxiv - Cell Biology 2021Quote: ... 6 μl of Trypsin/LysC solution [100 ng/μl 1:1 Trypsin (Promega) and LysC (FujiFilm ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and 75 μL (1:1 volume) of One-Glo™ reagent (E6110, Promega) was added to each well ...
-
bioRxiv - Neuroscience 2021Quote: ... IΒΑ1 (1:250, rabbit, Wako, 01919741) and p75NTR (1:1000, rabbit, G3231, Promega). Sections were washed 3×20 min in PBS prior to incubation with secondary antibodies (Alexa Fluor ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were then diluted 1:1 with Milli-Q water and trypsin (Promega) added at the same enzyme/protein ratio ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 mM DTT) or with 1 unit of RQ1 DNase (Promega; RNase-free) in 40 μL of RQ1 buffer (40 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2022Quote: ... 6 μl of Trypsin/LysC solution (100 ng/μl 1:1 Trypsin (Promega) and LysC (FujiFilm) ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were collected and mixed 1:1 with BrightGlo Luciferase assay reagent (Promega) and luminescence was measured using a luminometer (Molecular Devices ...
-
bioRxiv - Molecular Biology 2022Quote: ... alongside a 1:1 molar ratio of Luciferase (pGL4.23) to Renilla (pGL4.75, Promega) vectors ...
-
bioRxiv - Cell Biology 2020Quote: ... psPAX2 and pMD2.G at the ratio of 1:1:1 in HEK293T cells using ProFection® Mammalian Transfection System (Promega, E1200), medium was changed 16h post transfection and virus containing supernatant was harvested 48h later ...
-
bioRxiv - Biochemistry 2021Quote: ... the sample was diluted 1:1 with 50 mM ammonium bicarbonate and proteins were digested with trypsin (protein to enzyme ratio 1:50, Promega, Mannheim, Germany) overnight at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... The samples were diluted 1:1 with milliQ water and were incubated with a 1:100 w/w amount of trypsin (Promega, sequencing grade) overnight at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: First strand synthesis was performed in 25 μl reaction volumes using 5 μl of MMLV-RT 5X buffer (Promega, Wisconsin, UK), 1.25 μl of dNTPs (10mM ...
-
bioRxiv - Molecular Biology 2021Quote: ... Firefly luciferase activity was measured by adding 25 μL Luciferase Assay Buffer II (LARII) to 5 μL of lysate and measured immediately with the GloMax 20/20 Luminometer (Promega, E5311). Reactions were stopped and Renilla luciferase activity was measured by adding 25 μL Stop&Go reagent ...
-
bioRxiv - Cancer Biology 2020Quote: ... 25uL of reconstituted CellTiter-Glo Luminescent Cell Viability reagent was added to each well and incubated for 5 minutes (Promega, G7571). Luminescence readings were taken using the BioTek Synergy H1 Hybrid Reader ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated at 37°C (5% CO2) for 48 h before performing CellTiter-Glo (CTG) assays as per the manufacturer’s instruction (Promega, Madison, WI). Luminescence was read on a BioTek Synergy HTX plate reader (BioTek Instruments Inc. ...
-
bioRxiv - Biochemistry 2021Quote: ... The gel particles were eventually rehydrated on ice in a solution containing 5 ng/μL of trypsin (Promega, modified sequencing grade) in 50 mM NH4HCO3 ...
-
bioRxiv - Microbiology 2020Quote: ... The plates were cultured for two days at 37°C with 5% CO2 after which the supernatant was removed and replaced with 50 μl Nano-Glo Luciferase Substrate (Promega, Inc.). Light emission was measured in an Envision 2103 Multi-label plate reader (PerkinElmer ...
-
bioRxiv - Plant Biology 2020Quote: ... Individual reactions conducted with UGA-CPES consisted of a 10 µL mixture containing 5 µL of GoTaq Green Master Mix 2X (Promega Corporation), 0.5 µL of template DNA ...
-
bioRxiv - Microbiology 2021Quote: ... The migrated cells in the lower chamber were stained with 5 μl of CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega # G3580) for 2 h at 37° C with 5% CO2 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The α-tub∷GFP (Chung et al., 2014) plasmid was injected at 5-10ng/μl after purification using the PureYield Midiprep kit (Promega, #A2492).