Labshake search
Citations for Promega :
2001 - 2050 of 4976 citations for 6 methyl 4 oxo N phenyl 2 3 dihydro 1 4 oxathiine 5 carboxamide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Genomics 2019Quote: ... the gel slices were then hydrated with 5 ng/uL sequencing grade trypsin (Promega) in 50 mM ammonium bicarbonate and digested overnight at 37°C on an orbital shaker ...
-
bioRxiv - Genomics 2019Quote: ... 1989.) 5-mC free Lambda genomic DNA was purchased from Promega (Madison, WI, USA).
-
bioRxiv - Developmental Biology 2021Quote: ... embryos were co-injected with 5 pg of pRL-TK:renilla luciferase plasmid (Promega E2241) + 50 pg of the pGL4.23 luc2/miniP enhancer:luciferase plasmid and the following amounts of MOs or mRNAs into each dorsal marginal zone (dmz ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were subjected to a pulse with 5 µM biotin-HaloTag ligand (G828A, Promega) diluted in complete medium for 3 hours ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL GoTaq® Probe qPCR Master Mix with dUTP (2X) (Promega, Madison, WI), 0.2 μL GoScript™ RT Mix for 1-Step RT-qPCR (Promega ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... alongside 5 µl of broad molecular weight protein marker (Broad Range Molecular Marker, Promega), was loaded onto the gel and run at 200 volts for 55 minutes using a Mini-PROTEAN Electrophoresis System (Bio-Rad ...
-
bioRxiv - Plant Biology 2022Quote: ... Cells were collected and lysate in BugBuster (EMDMillipore) with 5 ul RQ1 DNase (Promega). The supernatant was flowed through a column packed with Ni-NTA (QIAGEN) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were allowed to grow for 5 days before adding an MTS reagent (Promega) and measuring absorbance at 492 nM on a BioTek Synergy H1 microplate reader (BioTek Instruments ...
-
bioRxiv - Genetics 2020Quote: Full-length wild-type and mutant Csde1 5’UTRs were inserted pGL3 (Promega, E1751) plasmid in between EcoRI and NcoI sites upstream of Firefly luciferase gene ...
-
bioRxiv - Immunology 2022Quote: ... followed by the addition of 5 μL RQ1 RNase-Free DNase (Promega, Cat# M6101) and incubation at 37°C for 15 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2ul/5-10mg DW of Trypsin/Lys-C (Endoproteinase LysC) Mix (Promega, Cat #V5071) was added to samples and incubated with continuous agitation at 150 rpm for overnight at 37°C ...
-
bioRxiv - Plant Biology 2022Quote: ... Proteins eluted at pH 9.0 were further treated with 5 U of CIAP (Promega) and the buffer provided by the manufacturer (a negative control was prepared without phosphatase) ...
-
bioRxiv - Molecular Biology 2022Quote: ... proteins were digested with chymotrypsin (5 ng/μL) at 25ºC overnight (Trypsin gold, Promega). Digestion was stopped by addition of 5% formic acid and peptides extracted twice with 70% acetonitrile and 5% formic acid (10 min sonication) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were incubated at 25°C for 5 days before CellTiter-Glo assays (Promega) were performed ...
-
bioRxiv - Immunology 2023Quote: ... Luciferase Assay System (E1501) and Passive Lysis 5 × Buffer (E1941) were purchased from Promega. C1q recombinant protein (A400 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μm tissue scrolls were processed using the Maxwell RSC RNA FFPE instrument (Promega). RNA concentration and quality was determined using a TapeStation automated electrophoresis instrument (Agilent) ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated with 5-100 pM of JF549-HTL (Cat. No. GA1110, Promega) and 50 nM Hoechst 33342 for an hour in complete medium ...
-
bioRxiv - Neuroscience 2023Quote: ... transferred to opaque 96-well plates containing 5 μM furimazine (NanoLuc Luciferase Assay, Promega), and bathed in 5-HT at various concentrations (ranging from 0.1 nM to 1 mM) ...
-
bioRxiv - Genomics 2024Quote: ... Trypsin digestion was done by adding 5 µL reductively methylated trypsin (Promega, Madison, USA) to each sample and incubating the samples overnight at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were performed using a 2× GoTaq PCR master mix (Promega), biotin-labeled M13F and biotin-labeled M13R primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of expressing plasmids were transfected using Fugene HD (Promega, #E2311). After 24 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2mM Mg(OAc)2 and 10μM of the amino acid mixture (Promega). Reactions were incubated with 5μM of the indicated nsp1 protein for 30 min on ice ...
-
bioRxiv - Plant Biology 2019Quote: ... total RNA (2 μg) was treated with RQ1 DNase (Promega, Madison, Wisconsin) and reverse-transcribed with the SuperScript VILO cDNA Synthesis Kit (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... A transfection solution containing 2 μl oligo-fectamine (Promega, Madison, WI, USA), 40 μl MEMI ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and were incubated with Glosensor reagent (Promega, 7.5 μL, 2% final concentration) for 90 min at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... All hADAR1/2 fragments were cloned into the pCI-Neo vector (Promega) to generate the pCI-ADAR vectors ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM DTT] containing 0.5 mM of freshly added rATP (Promega, E6011) in 10-μl reactions ...
-
bioRxiv - Cancer Biology 2021Quote: ... the samples were digested overnight with 2 μg sequencing grade trypsin (Promega) and trypsin inactivated by adding TFA to a final concentration of 1% v/v ...
-
bioRxiv - Molecular Biology 2021Quote: 50 nl of reverse transcription mix (2 mM (each) dNTP mix (Promega) and 0.8 Units Superscript III (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... On odd days 30 μl of Cell TiterGlo 2 (Promega cat # G924A) was added to the remaining 40 μl culture and incubated 10 min ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mL of Halo Magne bead slurry (cat. #G7287, Promega, Madison, WI) were washed with MilliQ water and 3 CV of modified CSF-XB ...
-
bioRxiv - Biochemistry 2021Quote: ... the samples were digested by addition of 2 % (w/w) trypsin (Promega) over night at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μl 5X colorless GoTaq reaction buffer (containing 7.5 mM MgCl2) (Promega), 6.225 μl deionized water ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were incubated with 2% of the GloSensor reagent (Promega, cat. # E1290). Relative luminescence units were recorded using a SynergyMx microplate reader (Biotek) ...
-
bioRxiv - Genetics 2020Quote: ... cells were transfected with 50 ng/well of the psiCHECK-2 (Promega) construct using the FuGENE HD Transfection Reagent (Promega) ...
-
bioRxiv - Microbiology 2022Quote: ... On-bead digestion was performed using sequencing-grade trypsin (2 μg; Promega) in 2 M urea in 100 mM triethylammonium bicarbonate (TEAB ...
-
bioRxiv - Systems Biology 2022Quote: ... Samples were shortly cooled to room temperature and 2 µl LysC (Promega) added pre-diluted in ultra-pure water to 2 ng/µl and digested for 4 h at 37°C in the thermal cycler ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were digested with 2 μg of trypsin (Promega, Madison, WI, USA) at 47°C for 2 h ...
-
bioRxiv - Cell Biology 2023Quote: ... and treated with 2 units of calf intestinal alkaline phosphatase (Promega; M182A) at 37°C for 10 min at 1000 rpm in a Thermomixer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dual Luciferase assay kit and PsiCHECKTM-2 vector were purchased from Promega. Oligonucleotides were synthesized and obtained from Eurofins Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... and digested for 2 hours at 50°C using Trypsin Platinum (Promega) using 1:50 Trypsin to sample ratio by mass ...
-
bioRxiv - Biochemistry 2023Quote: ... and incubated in 2 nM JF549-Halo-ligand (Cat. No. GA1110; Promega) for 15 minutes at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... Bovine alpha-2-hs-glycoprotein was isolated from plasma (Fetuin, Promega, V4961), and monocyte differentiation antigen CD14 was recombinantly expressed in CHO cells (R&D systems ...
-
bioRxiv - Cancer Biology 2023Quote: ... and program DLR-2-INJ on a Glomax 20/20 Luminometer (Promega) with 20μl cell extract as the input.