Labshake search
Citations for Promega :
151 - 200 of 2353 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... Gene-specific and transposon multiplex primer PCR was performed under standard conditions with 2X GoTaq Green Master Mix (Promega) with 5% DMSO (v/v).
-
bioRxiv - Physiology 2021Quote: ... RT was carried out using M-MLV RT enzyme (Promega #M1705) to obtain cDNA ...
-
bioRxiv - Microbiology 2019Quote: ... The RT-PCR fragments corresponding to the LP region were also cloned into a pGem-T easy vector (Promega) and Sanger sequenced.
-
bioRxiv - Molecular Biology 2024Quote: ... RT-PCR was used to amplify the OGDH 3’UTR and sub clone it into pmirGLO vector (Promega, UK). 5 × 10^4 C2C12 cells were seeded into 12 well plates ...
-
bioRxiv - Microbiology 2021Quote: ... followed by a reverse transcriptase (RT)-step with Moloney Murine Leukemia Virus RT (MMLV-RT, Promega, Madison, WI, USA) in the presence of RNase inhibitor (RNAsin plus ...
-
bioRxiv - Microbiology 2022Quote: ... and random primers (Promega). Quantitative PCR (qPCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... and random primers (Promega). Quantitative PCR were run using TaqMan probes (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... with random primers (Promega) and rRNasin® Plus Ribonuclease Inhibitor (Promega) ...
-
bioRxiv - Bioengineering 2022Quote: ... with random primers (Promega) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo-dT primers (Promega) and M-MLV Reverse Transcriptase kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Random primers (Promega), according to the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... with random primers (Promega), following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... with random primers (Promega). Real time PCR was performed on the CFX96 thermocycler (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... and random primers (Promega), generating cDNA ...
-
bioRxiv - Cancer Biology 2019Quote: ... random primers (C1181, Promega), RiboLock(tm ...
-
bioRxiv - Cell Biology 2021Quote: ... using Random primers (Promega) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... random primers (Promega #C1181), and GoScript reverse transcriptase kit (Promega #A5003) ...
-
bioRxiv - Molecular Biology 2022Quote: ... oligo(dT) primer (Promega) and M-MLV reverse transcriptase (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... and random primers (Promega). RT-qPCR was performed using Power SYBR Green (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... and random primers (Promega), as instructed by the manufacturers ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative PCR (qPCR) was performed with the primers listed in Table S1 and a GoTaq qPCR Master Mix (Promega, A6002) in a Mastercycler realplex2 thermocycler (Eppendorf) ...
-
bioRxiv - Developmental Biology 2019Quote: A 604bp in situ probe for desmogon was generated from total cDNA of stage 33 medaka embryos by PCR using the following primers fwd: TTCTGCGAGATCAGGCTCAC rev: AAGGCCCCTCCTCTGTAACT and subsequently A-tailed and cloned into a PGEMTeasy vector (Promega). Sense and anti-sense probes were generated using Sp6 and T7 polymerases (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... coli HT115 gadA gene was amplified by PCR using primers NgadAFw and NgadARw with Taq polymerase and cloned in the pGemT Easy plasmid (Promega) according to manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2021Quote: ... Genomic regions flanking the CRISPR target sites were PCR amplified with designed primers (Supplemental Table 3) using GoTaq DNA polymerase (Promega) and sent for Sanger sequencing to determine the insertion and deletion errors generated by CRISPR-Cas9 system in exon 2 of PARKIN ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 μL DNase I digested small RNA extracted from NF- and NF+ were reverse transcribed with random primers and the cDNA was used for PCR by using GoTaq flexi DNA polymerase (Promega). 100 ng total RNA extracted from Arabidopsis protoplast cells were reverse transcribed and used as positive control to indicate the proper size of amplified products ...
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Microbiology 2022Quote: The upstream regions of genes of interest were amplified by PCR with specific primers (Table S1) and cloned into the pGEM-T easy plasmid (Promega). After digestion with proper restriction enzymes (Table S1) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The VEGFA probe was a 600bp fragment amplified using PCR from HH stage 15 embryo cDNA using primers CCATGAACTTTCTGCTCACTTGG and CTGCTCACCGTC-TCGGTTTTTC and cloned into pGEM-T Easy (Promega). The VEGFR2 probe was a generous gift from C ...
-
bioRxiv - Plant Biology 2021Quote: ... benthamiana cDNA using gene-specific primers listed in Supporting Information Table S1 as a NcoI-KpnI fragment by High Fidelity PCR (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sense (5’-AGGAAACTGAAAAACAGAGTAGCAGC-3’) and antisense (5’-TCCTTCTGGGTAGACCTCTGG-3’) primers were used in a standard GoTaq Green PCR reaction (Promega) to amplify a region spanning the 26-nucleotide intron that includes a single PstI restriction site ...
-
bioRxiv - Bioengineering 2019Quote: ... a specific WDV nucleotide sequence (140 bp, primers UniWDVfw+UniWDVrv) amplified by PCR was inserted into the vector pGem-T Easy (Promega) and cloned into E ...
-
bioRxiv - Plant Biology 2019Quote: ... and the presence of T-DNA alleles or wild-type alleles was tested via PCR using gene-specific and the LBb1.3 primers (Table S3) using the GoTaq® Hot Start Polymerase (Promega). The program was ...
-
bioRxiv - Synthetic Biology 2021Quote: ... were generated by in vitro transcription from DNA templates generated by PCR amplification or by fill-in with primer T7X (Supplementary Table 1) using GoTaq (Promega). DNA was purified using QiaQuick (Qiagen) ...
-
bioRxiv - Microbiology 2019Quote: ... 5 µl of the cDNA reaction mixture was used as a template in a 50 µl PCR amplification reaction mixture with corresponding forward and reverse primers (Table S2) and GoTaq DNA polymerase (Promega), as described by the supplier ...
-
bioRxiv - Neuroscience 2019Quote: ... The quality of the cDNA was tested using GPDH primers (see below for sequence) and GoTaq endpoint polymerase chain reaction (PCR) protocol (Promega). Quantitative PCR was performed using a SYBR Green protocol (Applied Biosystems ...
-
bioRxiv - Biochemistry 2021Quote: ... gDNA was purified using Purelink spin columns and PCR amplified with specific primers (Supplementary Table S3) using GoTaq Hot Start Polymerase (Promega). PCR conditions were 95°C for 3 min ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
bioRxiv - Neuroscience 2022Quote: The scATAC-seq peaks that overlapped obesity-associated SNPs were PCR amplified from human genomic DNA (see primers in Supplementary Table 2) and cloned into the pGL4.23 plasmid (Promega, E84111). The associated SNPs were then introduced into these plasmids by PCR amplification with primers containing the associated variants ...
-
bioRxiv - Microbiology 2022Quote: ... Further taxonomic affiliation was carried out on these clones after PCR amplification of the rDNA genes using the same primers as above and Pfu DNA polymerase (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Hybridization probes were generated by PCR amplifi cation using gene specifi c primers (Table S1) and radiolabeled with the Prime A Gene labeling kit (Promega) following the recommendations of the manufacturer.
-
bioRxiv - Neuroscience 2023Quote: ... The presence of a 108 bp deletion in Stx6 was determined using two PCR reactions with the following primer combinations with GoTaq G2 Hot Start Polymerase (Promega): PCR 1 forward 5’-CGATCTGTGAGACTCATCGGG and reverse 5’-GGGAGTCCTAACACCACCTTC ...
-
bioRxiv - Plant Biology 2023Quote: The HLB1 coding sequence corresponding to the N-terminal 200 amino acids was amplified by PCR using the following primers and was cloned into pGEM-T-easy vector (Promega). The NdeI and XhoI fragment of HLB11-200 was cloned into pET28a vector (Novagen ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCRs were performed with MLV SU or 2-LTR primers (Table 1) using a Power SYBR green PCR kit (Promega) and the QuantStudio 5 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... MSIL4-GFP/MSIL4G-tagged version used for complementation and RIP corresponds to the fusion of a genomic PCR product containing MSIL4 promoter (primers TL3527(HindIII)-TL3528(SalI)) fused with a second PCR cDNA fragment (primers TL3529(SalI)-TL3530(BamHI)) cloned initially in pGEM T Easy (Promega). After sequencing the fusion DNA has been cloned in the binary vector CTL579 containing GFP cDNA sequence ...
-
bioRxiv - Developmental Biology 2023Quote: The highly conserved 998-bp core sequence of Xenopus tropicalis MFCS1 was amplified by PCR with specific primers (Table S3) and inserted into the Acc65I and XhoI sites of the pGL4.23 vector (Promega, E8411). Then the minimal promoter of the pGL4.23 vector was replaced with a 486-bp sequence of Xenopus laevis shh promoter (Fig ...
-
bioRxiv - Microbiology 2023Quote: ... Gene expression was assessed by qPCR using primers listed in the supplemental material Table S6 and the GO Taq PCR kit (Promega). Gene expression was quantified using SYBR Green (Roche ...
-
bioRxiv - Microbiology 2023Quote: The region upstream of the genes of interest was amplified by PCR with proper primers (Table S4) and cloned into the pGEM-T easy plasmid (Promega). The insert was removed by digestion and subcloned into the pRKlacZ290 vector to generate transcriptional fusions to the lacZ gene ...
-
bioRxiv - Microbiology 2023Quote: ... core and modified histones and transcription factors at the HIV-1 LTR was assessed by quantitative PCR using primers spanning the full promoter (Table 1) with GoTaq qPCR Master mix kit (Promega) in a CFX Connect Real-Time PCR thermocycler (BioRad) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Digoxigenin-labelled or Fluorescein-labelled mRNA probes were either prepared as PCR probes with primers listed in Table S4 using the Kit GoTaq green master mix (Promega) or as described (Orgeur et al. ...
-
bioRxiv - Microbiology 2024Quote: ... named rpsL*) was amplified by PCR with primers BlD-LLcfusARpsL/BlD-LLldacARpsL and cloned into the pGEM-T Easy vector (Promega), yielding plasmid pGEM-rpsL* ...