Labshake search
Citations for Promega :
151 - 200 of 1947 citations for R 4 5 Isopropylidene 2 pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: Total RNAs were obtained using Maxwell(R) RSC Plant RNA Kit (Promega). For RNA-Seq ...
-
bioRxiv - Biochemistry 2021Quote: ... A 15-amino acid linker and SmBiT subunit (peptide 86, Promega) were attached to the C-terminus of rat Gβ1 ...
-
bioRxiv - Bioengineering 2023Quote: ... and subsequently stained with Diamond™ Nucleic Acid Dye (Promega, H1181) for 10 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... a complete standard mixture of amino acids (Promega, Medison, WI, USA) was analyzed by CE-MS to obtain MS and MS/MS spectra of the proteinogenic amino acids ...
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acid extracts were treated using RQ1 RNAse-free DNAse (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... the Maxwell Viral Total Nucleic Acid Purification kit (Promega, Madison, WI) was used to isolate viral RNA (vRNA ...
-
bioRxiv - Biochemistry 2024Quote: ... and then counterstained with Diamond™ Nucleic Acid dye (Promega Corporation) to visualize competitor oligos ...
-
bioRxiv - Bioengineering 2020Quote: ... β-mercaptoethanol (3.4 × 10−4%, Promega) and Penicillin (1% ...
-
bioRxiv - Bioengineering 2020Quote: ... β-mercaptoethanol (3.4 × 10−4%, Promega) and Penicillin (1% ...
-
bioRxiv - Bioengineering 2020Quote: ... β-mercaptoethanol (3.4 × 10−4%, Promega) and Penicillin (1% ...
-
bioRxiv - Microbiology 2023Quote: ... 4 mM magnesium chloride (Promega), 0.4 mM dNTPs (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... 4% PEG 8000 (Promega, V3011), 5 mM NaCl ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 4% D-luciferin (Promega). The luciferase substrate permeated the cells for 120 min at 37 ℃ ...
-
bioRxiv - Neuroscience 2024Quote: ... 4 units RQ1 DNase (Promega), protease and phosphatase inhibitors (ThermoFisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... with an added 5’-CACC-3’ at 5’-end and 5’-AAAC-3’ at 5’-end of the complementary strand were annealed in 10xT4 ligation buffer (Promega M1801) by continuous cooling from 95°C to 25°C ...
-
bioRxiv - Genetics 2020Quote: ... DNA concentration was measured using the QuantiFluor(R)dsDNA System(a) (Promega, USA) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... Firefly and Renilla luciferase activities were measured using a luminometer (Promega GloMax(R) Navigator with Dual Injectors) ...
-
bioRxiv - Developmental Biology 2024Quote: ... luciferase expression was assayed using the Dual-Luciferase (R) Reporter Assay System (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: ... with m7G(5')ppp(5')G RNA Cap Structure Analog (ref. S1404L, Promega) as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... 2) Thermolysin (Promega) or 3 ...
-
bioRxiv - Microbiology 2021Quote: ... (2) Trypsin (Promega), 4 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Erk1/2 (Promega), phospho-Erk1/2 (Promega) ...
-
bioRxiv - Microbiology 2023Quote: ... 5’-CGCCTTCGTTACAAGCATCG-3’; antisense, 5’-AAGAGCAAACGCATCTCCGA-3’), GAPDH (sense, 5’-ACCCACTCCTCCACCTTTGAC-3’; antisense, 5’-CTGTTGCTGTAGCCAAATTCGT-3’) using Green GoTaq master mix (Promega, Madison, WI) with C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μg of RNase A (Promega), and 40 units of RNase ONE (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 µl RT buffer 5x (Promega), 2.5 μl dNTPs 2.5 mM ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 µg Trypsin/LysC mix (Promega) were added and the sample incubated for 4 h at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 µg Trypsin/LysC mix (Promega) were added and the sample incubated for 4 h at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μL refolding reaction was diluted 1:5 into luciferase assay system mix (Promega), and luminescence was measured on the GloMax-20/20 Luminometer (Promega) ...
-
bioRxiv - Bioengineering 2021Quote: ... and quantified on a Quantus™ Fluorometer using the QuantiFluor(R) dsDNA System (Promega). The quantification of copies of 16S rDNA was divided by the number of copies naturally present per cell (5 copies·cell-1 according to rrnDB database) ...
-
bioRxiv - Cancer Biology 2023Quote: ... CellTiter 96(R) AQueous MTS Reagent Powder were provided by Promega (Madison, Wisconsin, USA). NdCl3 (>99% ...
-
bioRxiv - Neuroscience 2023Quote: ... miR153 Upstream Seq HindIII R: TATATAAAGCTTCTAAGTAGCTGGCAAAGT) of promoter-less pGL4.10 Firefly luciferase construct (Promega), and the NFAT binding site mutated via site directed mutagenesis (miR153 NFAT Mut F ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μM HaloTag-TMR (Promega), 47 U/μL Ready Lyse Lysozyme (Epicentre) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL Greenflexi buffer (Promega), 2 µL dNTP (Promega U151B ...
-
bioRxiv - Pathology 2021Quote: ... 5 μl MgCl2 solution (Promega), 5 μl of PCR DIG labelling mix (Roche) ...
-
bioRxiv - Biochemistry 2020Quote: ... and 5 µL RNasin (Promega), and tumbling for 2 hours at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... DNase (5 units/ml, Promega)) and incubated 40 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL CellTiter-Flour (Promega) was added per well to measure cell viability and compounds toxicity ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 ng pRL-SV40 (Promega), and 375 ng total amount of testing plasmids individually or in combinations ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µl H2O (Promega, P1199). Samples were incubated 1 hour at 56°C followed by 16 to 24 hours at 80°C and a holding step at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg/mL Trypsin (Promega), 2 M urea ...
-
bioRxiv - Plant Biology 2021Quote: The optimised HaloTag®-7 sequence (298 amino acids) from Promega (https://www.promega.de/) was genetically split on position 155/156 aa into the N-terminal fragment “NHalo” (aa 1-155 ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by DNA staining with Diamond™ Nucleic Acid Dye (Promega, Madison, WI)
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 μl of premix [100 μM amino acid mixture without methionine (Promega), 100 μM amino acid mixture without leucine (Promega) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μl of premix [100 μM amino acid mixture minus methionine (Promega), 100 μM amino acid mixture minus leucine (Promega) ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was purified according to manufacturer instructions using phenol:chloroform nucleic acid extraction (Promega).
-
bioRxiv - Microbiology 2024Quote: ... or Maxwell 16 Viral Total Nucleic Acid Purification Kit (Promega Corporation, Madison, USA) for viral detection in cell culture supernatant ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL BSA (1 mg/mL) and 2 μL buffer H (Promega) in reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... in pbs containing 5 mM glucose and supplemented with 5 µM of Nanoglo (Promega #N1120) or coelenterazine-H (Dalton #50909-86-9) ...
-
bioRxiv - Genomics 2024Quote: ... and MgCl2 (final 5 mM) and 5 units of RQ1 RNase-free DNase I (Promega) were added ...