Labshake search
Citations for Promega :
151 - 200 of 4810 citations for 7 hydroxy 1H 1 2 4 triazolo 1 5 a pyrimidin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Halo-MDC1 deletion mutants were expressed transiently by transfecting ∼ 5 × 105 cells with 1 µg of plasmid DNA using FuGene 6 (Promega). For genome editing ...
-
bioRxiv - Microbiology 2022Quote: ... between 0.5 to 1 µg of total RNA was reverse transcribed into cDNA using an ImProm II Reverse Transcriptase kit (Promega). Equal amounts of cDNA were quantified by RT-qPCR using the IQ SYBR green Supermix (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μL of a solution that is 1 mM in each of the 20 essential amino acids (Promega, No. L4461); 20 μl of Promega S30 Premix without Amino Acids (No ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were harvested day 1 and day 5 post-infection using a CellTiter-Glo Luminescent Cell Viability Assay Kit (Promega) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 1.7 μg of attB-hACE2-mNG2-1-10 plasmid or attB-S-mNG2-11 plasmid were added into 5 μL FuGENE 6 transfection reagent (Promega) and OptiMEM (Gibco ...
-
bioRxiv - Plant Biology 2022Quote: The dual luciferase assay (Figure 1 – figure supplement 5) was based on the Dual- Luciferase® reporter assay system (Promega). N ...
-
bioRxiv - Biochemistry 2022Quote: ... with 10 ng pGL4.32[luc2P/NF-κB-RE/Hygro] (NF-κB response element-dependent firefly luciferase) or pGL4 [luc2P/AP-1-RE/Hygro] and 5 ng pRL-TK using the Dual Luciferase Reporter Assay (Promega). 24 hours post transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... We performed targeted PCR by adding 1 μL of cell lysate (1:5 dilution) to a 25-μL PCR reaction containing GoTaq Hot Start Master Mix Green (Promega) and 0.5 μL of the primers (10 µM ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... was co-transfected at a 1:5 ratio with either the HaloTag-ubiquitin plasmid (expressing Ub-Halo) or the HaloTag control (Promega). Transfected cells were incubated for 20 h at 37 °C ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were diluted 5-fold with 25 mM Tris pH 8.0 and 1 mM CaCl2 prior to digesting them with trypsin (Promega, V511X) at a 1:30 enzyme-to-protein ratio at 37 °C in a dry bath for 16 h.
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2020Quote: ... the cells for the luciferase assay were exposed to 100 μL of a 1:1 dilution of DMEM and luciferase substrate (ONE-Glo Luciferase Assay System, Promega), and luminescence from each well measured in a GloMax-96 Microplate Luminometer (Promega) ...
-
bioRxiv - Cell Biology 2022Quote: ... diluted by 4-fold to reduce urea to 2 M for the addition of trypsin (Promega, 1:50 w/w) to continue the digestion at 21°C overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... diluted by 4-fold to reduce urea to 2 M for the addition of trypsin (Promega, 1:50 w/w) to continue the digestion at 21ºC overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM iodoacetamide (IAA) and proteins were eluted by digestion with 5 µg/ml trypsin (Promega). Eluted proteins were fully digested overnight ...
-
bioRxiv - Microbiology 2019Quote: ... or mCherry were amplified by PCR (5’-CCGGGTACCATGGGCAGCAGCCATCATC and 5’-CGGGAATTCTTACTTGTACAGCTCGTCCAT primers; Pfu DNA polymerase, Promega) from the pRGrectac-NHis constructions (Fernández-Tresguerres et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 units GoTaq DNA polymerase (Promega) and water to 50μl ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 μL ADP-Glo reagent (Promega) was added to each reaction mixture and incubated for 40 min at 25°C ...
-
bioRxiv - Biochemistry 2020Quote: ... and 5 µL RNasin Plus (Promega) per sample to 800 µL lysate and 1.5-2 hours of rotation at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μM HaloTag-TMR ligand (Promega), Ready-Lyse Lysozyme (47 U/μl ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of CTG reagent (Promega G7571 ...
-
bioRxiv - Immunology 2023Quote: ... 5 ng of pRL-TK (Promega), and 5 ng of pEF-Slc46 expression plasmid using GeneJuice (Millipore ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mg/mL proteinase K (Promega)) and incubated overnight at 50°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 μl of CellTiter-Blue (Promega) was added and cells were incubated for 90 minutes at 37°C before measuring fluorescence using an EnVision plate reader (PerkinElmer) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2 μL/well of One-Glo detection reagent (Promega, cat # E6120) was added to all microplate wells via Multidrop ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 mM isopropyl β-d-1-thiogalactopyranoside (IPTG; Promega) was added to each RNAi well for induction of dsRNA synthesis and plates were incubated for 3-4 hours at 30°C and 155 rpm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl of 4 mg/ml RNase A (Promega) was added and the sample incubated for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 mM Tris-HCl (pH 7), 1% Triton X-100, 1% NaDOC, 100 μg/mL cycloheximide (Applichem, Germany) and 30 U/mL RNase Inhibitor (Promega, United States)] ...
-
bioRxiv - Neuroscience 2024Quote: ... The WT and mutated 5’UTR sequences were ligated into a linearized reporter plasmid (psiCHECK-2 vector, Promega). The entire sequences of all the plasmids were validated by Sanger sequencing ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL BSA (1 mg/mL) and 2 μL buffer H (Promega) in reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Immunology 2019Quote: ... BRET1 between hRLuc8 and mVenus was measured 5 min after addition of 5 µM coelenterazine H (Promega). BRET1 readings were collected using a Mithras LB940 reader (Berthold) ...
-
bioRxiv - Biochemistry 2021Quote: ... and then cells were pre-incubated 5 minutes at 37°C with 5 μM coelenterazine h (Promega) before adding ligands diluted in PBS supplemented with 0.9 mM CaCl2 and 0.5 mM MgCl2 ...
-
bioRxiv - Biochemistry 2021Quote: ... and then cells are pre-incubated 5 minutes at 37°C with 5 μM coelenterazine h (Promega) before adding ligands diluted in PBS supplemented with 0.9 mM CaCl2 and 0.5 mM MgCl2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 5’ UTR of mouse 5’-tRFCys targets or non-target Gapdh were cloned into psiCHECK2 (Promega). Synthetic 5’-tRF-Cys antisense or a scrambled control sequence embedded in the tough decoy backbone (Haraguchi et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... gDNA was amplified using primers 5’-AGTCCCTTCCTTGTCACTTAGT-3’ and 5’-ATCTCACAAGAAAGCGAAATCC-3’ and GoTaq DNA Polymerase (Promega), then digested using EcoRV (New England Biosciences) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The primer pair (5′- accagacggagtttgagcgcgtcttcTGAGGAGGATCCGGTGGAGCTAGCGGAAGA-3′ and 5′-ctccaccgagtcgtactgcttcgccatACCAGAATTCCCACCGCTCGAGCCA-3′) and pBit3.1-N (Cat. No. N2361, Promega) were used to clone the vector-containing fragment ...
-
bioRxiv - Biophysics 2022Quote: ... Blots were incubated with secondary antibodies for 1h at room-temperature (1:10000 in 5% skim-milk powder, anti-rb-HRP-conjugate (Promgea, W401B)/anti-ms-HRP-conjugate (Promega, W402B)) ...
-
bioRxiv - Genomics 2022Quote: ... Membranes were washed in TBST and probed with anti-mouse HRP secondary antibody (Promega; 1:2,000 in 5% BSA in TBST) for 1 hour at room temperature followed by development in ECL (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Nanoluciferase bioluminescence was measured from the Hyp1-Nluc parasites by lysing the parasite culture 1:5 with 1x Nano-Glo Lysis Buffer (Promega, USA), and the addition of 1:1000 Nano-Glo (Promega) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Membranes were washed in TBST and probed with anti-mouse HRP secondary antibody (Promega; 1:2000 in 5% BSA in TBST) for 1 h at room temperature followed by development in ECL (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... These cells were transfected with the pcDNA6.2-GW /EmGFPmiR plasmids containing miR sequences (miR-NRF2 #1, #2, #3, #4 and miR-ctl 79 using the FUGENE HD transfection reagent (Promega #E2311). Seven days later GFP positive cells were isolated by flow cytometry (Biorad S3e cell sorter) ...
-
bioRxiv - Cell Biology 2022Quote: ... t-ERK1/2 (Promega V114A, 1/1000 dilution), p-AKT (Cell Signaling Technology ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μg trypsin (protein:enzyme ratio 50:1; Promega) were added and proteins were digested at 37 °C for 18 h ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated with NBT–BCIP (nitro blue tetrazolium–5-bromo-4-chloro-3-indolyl-phosphate) AP substrate (Promega, Catalog # S3771) for in situ cell staining ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Recombinant baculovirus was produced by transfecting recombinant bacmids (2-3 μg) into Sf9 cells (5 mL, density of 4×105 cells per mL) using FuGENE HD Transfection Reagent (Promega) and Opti-MEM Reduced Serum Media (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated ∼18 hours at 37°C and individual white colonies screened for insert by colony PCR using primers M13_F (5’-ACGACGTTGTAAAACGACGGCCAGT-3’) and M13_R (5’-ATTTCACACAGGAAACAGCTATGACCA-3’) GoTaq DNA Polymerase (Promega). Reactions were separated by gel electrophoresis ...
-
bioRxiv - Genetics 2022Quote: ... The DNM1 amplification was performed with specific primers pair (DNM1_Forward 5’-GGGTCTTGTACGGAGCAGGG-3’ and DNM1_Reverse 5’-GAGTCAGATAGTAAGGGCAAGCAC-3’) using Pfu DNA polymerase (Promega). After the first amplification to select DNM1 fragment of 761 bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNase-treated RNA was ligated with a 5’-hydroxylated ‘Processed Start Site’ (PSS) RNA adaptor oligomers (onkh031) by RNA Ligase 1 (Promega or NEB) and then purified to remove excess oligomers (NEB Monarch RNA Cleanup kit) ...