Labshake search
Citations for Promega :
151 - 200 of 4171 citations for 6H 1 3 5 Trioxepino 6 7 f benzimidazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... the Caspase-Glo 3/7® or Caspase-Glo 8® assay (Promega) was performed according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Caspase activity was quantified using the Caspase-Glo 3/7 Assay Kit (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... Cell viability and caspase 3/7 activity was measured with CellTiter Flo (Promega) or CaspaseGlo (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability and caspase 3/7 activity was measured with CellTiter Glo (Promega) or Caspase Glo (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... or the Caspase Glo® 3/7 Assay (Promega Corporation, Madison, WI, USA) following the manufacturer’s protocol and plates were read on an EnVision Multilabel Plate Reader (Perkin Elmer ...
-
bioRxiv - Cancer Biology 2023Quote: ... and apoptosis was determined using the Caspase 3/7 Glo Assay (G8090, Promega) measuring luminescence with a BioTek Synergy 2 (BioTek/Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: Apo-ONE® Homogeneous Caspase-3/7 Assay (Promega Corporation, Madison, WI, USA) was used to determine the caspase activity in the extracted tumors ...
-
bioRxiv - Cancer Biology 2020Quote: ... was determined at day 3 and 4 post-transfection using the Caspase-Glo 3/7 Assay (Promega, Mannheim, Germany). The emerging fluorescence was detected (485Ex/527Em ...
-
bioRxiv - Plant Biology 2022Quote: ... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated ∼18 hours at 37°C and individual white colonies screened for insert by colony PCR using primers M13_F (5’-ACGACGTTGTAAAACGACGGCCAGT-3’) and M13_R (5’-ATTTCACACAGGAAACAGCTATGACCA-3’) GoTaq DNA Polymerase (Promega). Reactions were separated by gel electrophoresis ...
-
bioRxiv - Genetics 2022Quote: ... The DNM1 amplification was performed with specific primers pair (DNM1_Forward 5’-GGGTCTTGTACGGAGCAGGG-3’ and DNM1_Reverse 5’-GAGTCAGATAGTAAGGGCAAGCAC-3’) using Pfu DNA polymerase (Promega). After the first amplification to select DNM1 fragment of 761 bp ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’int-F and 24nt-6stp-R primers and 2) 3’KI: 24nt-6stp-F and 3’int-R using the GoTaq DNA polymerase mix (Promega, Madison, WI) and 200 nM of each primer ...
-
bioRxiv - Microbiology 2019Quote: ... 500 nM of each primer (5’-TCCTGCTCAACTTCCTGTCGAG-3’ and 5’-CACAGGTCAAACCTCCTAGGAATG-3’) and 0.1 µL hot-start Taq DNA polymerase (Promega) in 20 mM Tris−HCl pH 8.3 ...
-
bioRxiv - Biochemistry 2020Quote: ... Each well was transfected with 3 uL FuGENE 6 reagent (Promega) and 130 ng pcDNA3-mouseSTING in line with manufacturer’s protocols.
-
bioRxiv - Cell Biology 2020Quote: ... Caspase 3/7 activity was measured using an Apolive-Glo kit (Promega, Madison, WI) and measured using a SpectraMax M5 (Molecular Devices ...
-
bioRxiv - Physiology 2020Quote: ... caspase 3/7 activity was measured using ApoLive-Glo Multiplex Assay (Promega, Madison, WI). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell apoptosis was assessed using either the CaspaseGlo 3/7 assay (G8090, Promega, UK) according to the manufacturer’s instructions (N=4 replicates) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Effector caspase activity was assessed using the Caspase-Glo 3/7 Assay System (Promega) following a previous protocol (Ronai et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal volume of Caspase-Glo® 3/7 Assay System (Cat. No.G8090, Promega) was transferred into each well and incubated for 1 h and measured by a GloMax® 20/20 Luminometer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and caspase-3/7 activity were measured using the ApoTox-Glo Triplex Assay (Promega) in a GloMax-Multi+ Reader (Promega) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Apoptotic activity was determined by the Caspase-Glo 3/7 luminescent assay (Promega, G8092), Annexin-V staining (Roche ...
-
bioRxiv - Bioengineering 2020Quote: ... Cell apoptosis was measured using a Caspase-Glo 3/7 assay (Promega, Madison, WI).
-
bioRxiv - Cancer Biology 2023Quote: ... survival was assessed using Cell Titer-Glo and Caspase 3/7 Glo assays (Promega) and analyzed at 24–48h post-treatments ...
-
bioRxiv - Cell Biology 2023Quote: Caspase activity was assessed using Caspase-3/-7 Glo Luminescent Assay (Promega, Madison, WI) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... the Caspase-Glo® 3/7 assay was performed according to manufacturer’s instructions (Promega) on HEK cells after 40 h treatment with cisplatin ...
-
bioRxiv - Immunology 2023Quote: ... and an apoptosis assay using Caspase-Glo® 3/7 reagent (G8091, Promega, Canada), as per manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: Apoptosis was assessed using the luminescence-base Caspase-Glo 3/7 assay kit (Promega) and defined by at least a 1.5-fold increase in signal activation concerning controls ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... COS-7 cells were plated on 10 cm plates and transfected 24h prior to lysis using FuGENE 6 (Promega; 6-12 µg total DNA). For siRNA tests ...
-
bioRxiv - Cell Biology 2023Quote: ... COS-7 cells were plated on 10 cm plates and transfected 24h prior to lysis using FuGENE 6 (Promega; 6-12 µg total DNA). Cells were routinely tested for mycoplasma using a MycoAlert detection kit (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... Standard RNA was synthesized from a partial region of the GPC gene using the forward (5’-TAATACGACTCACTATAGGGCCAACCTTTTTGCAGGAGGC-3’) and reverse (5’-AGCTTCTTCTGTGCAGGATCTTCCTGCAAGCGCTAGGAAT-3’) primers and the T7 RNA polymerase (Promega), as previously described (Pemba et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination was amplified using primers PV3-F2 (5′-CTCCAAAGTCCGCATTTACA-3′) and PV1-R2 (5′-ATCAGGTTGGTTGCTACA-3′) and Taq polymerase (Promega) with an initial denaturing at 95°C for 2 min ...
-
bioRxiv - Cell Biology 2019Quote: ... The full-length coding sequence of murine Tmem98 was amplified from a mix of murine embryonic and murine keratinocyte cDNA using forward 5’-AAAAAGCTTGCCATGGAGACTGTGGTGATCGTC-3’ and reverse 5’-TTTTGAATTCTTAAATGGCCGACTGTTCCTGCAGGAAGC-3’ primers and cloned into pSP72 (Promega) as a HindIII/EcoRI fragment ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of each primer (C1105 5’-GGTTCATCGACATCTCCGCG-3’ and C1106 5’-AGGTCGCTGCGCATGCCAATC-3’) and 1.25 units of GoTaq® DNA polymerase (Promega). The cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Cancer Biology 2022Quote: SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
bioRxiv - Cancer Biology 2019Quote: ... Sense (5’-AGGAAACTGAAAAACAGAGTAGCAGC-3’) and antisense (5’-TCCTTCTGGGTAGACCTCTGG-3’) primers were used in a standard GoTaq Green PCR reaction (Promega) to amplify a region spanning the 26-nucleotide intron that includes a single PstI restriction site ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM MgCl2 (pH 7) and 40 U RNasin® Ribonuclease Inhibitor (Promega) at 30° C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM MgCl2 (pH 7) and 40 U RNasin® Ribonuclease Inhibitor (Promega) at 37° C 60 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... Caspase activity was determined using Caspase-Glo® 3/7 Assay Systems (Promega, Madison, WI) according to the manufacturer’s specifications ...
-
bioRxiv - Developmental Biology 2019Quote: ... The Promega Caspase-Glo® 3/7 Assay Systems (Promega, Madison, WI, Cat No. G8091) was used to quantify apoptotic cell death
-
bioRxiv - Microbiology 2021Quote: ... caspase activity was measured using Caspase-Glo 3/7 Assay according to manufacturer’s instructions (Promega). Staurosporine (1μM ...
-
bioRxiv - Neuroscience 2020Quote: Caspase activity was measured using a chemiluminescent assay kit (Promega Caspase-Glo® 3/7) in 96-well format using an Analyst HT plate reader (Molecular Devices ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated for 24 hr before adding 40 μl of Caspase-Glo 3/7 (Promega) to each well ...
-
bioRxiv - Cancer Biology 2021Quote: ... The remaining cells in the inserts were analyzed with Caspase-Glo 3/7 assay (Promega) to confirm that Jurkat cells incubated with TAM CM did not induce apoptosis compared to the control medium.
-
bioRxiv - Cell Biology 2020Quote: ... Caspase activation was measured using the CaspaseGlo 3/7 Assay Kit (Promega, Madison, WI, USA) according to manufacturer’s instructions for the indicated time point presented in the figure legend ...
-
bioRxiv - Cell Biology 2022Quote: ... Apoptosis was assessed by commercially available caspase 3/7 assay (Cat # G8090, Promega, Madison, WI) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 1,3 μg of plasmid DNA and 3 μl of FuGene 6 (Promega) were mixed in 100 µl Opti-MEMTM medium before the addition to the dish ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...