Labshake search
Citations for Promega :
151 - 200 of 2066 citations for 3 hydroxy 20 oxopregn 5 en 21 yl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... that introduced a 5’ KpnI site and a 3’ XhoI site and cloned into the pGL3 firefly luciferase vector (Promega). Site directed mutagenesis was performed as described above ...
-
bioRxiv - Plant Biology 2022Quote: ... primer extension products reverse-transcribed with a gene-specific primer (reverse-complementary to the 16S rRNA nucleotides 1092-1108; 5’-CAGTCTGTTCAGGGTTC-3’) and AMV reverse transcriptase (Promega) were analyzed by qPCR with the primer pairs ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... Oligonucleotides encoding guide RNAs targeting M18BP1 (5’- TTGTACTGAAAAAATCATCA-3’) were cloned into pX459-v2 and co-transfected using FuGENE 6 (Promega) with pUC19 containing a 1528 base pair stretch containing the mutated sequence of the locus of interest and homology arms ...
-
bioRxiv - Developmental Biology 2024Quote: ... a minimal promoter (5′-AGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAG-3′) and 8x Gli1-binding sites (110) were cloned into the pGL3-Basic vector (Promega), in which Firefly luciferase was replaced with NanoLuc luciferase amplified from the pNLF-N [CMV/Hygro] vector (Promega ...
-
bioRxiv - Cancer Biology 2020Quote: ... Luminescence was measured using GLOMAX 20/20 Luminometer (Promega). Luciferase activity was normalized with Renilla activity.
-
bioRxiv - Microbiology 2022Quote: ... and detected with a GloMax 20/20 Luminometer (Promega) at 18 hours post-infection ...
-
bioRxiv - Microbiology 2024Quote: ... and detected with a GloMax 20/20 Luminometer (Promega) or Varioskan LUX Multi-well Luminometer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... and detected with a GloMax 20/20 Luminometer (Promega) or Varioskan LUX Multi-well Luminometer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µg of protein was diluted 5 times with 50 mM ABC and trypsin was added with a 1:20 trypsin to sample ratio (Promega, V5117). Protein were digested 24 h at 37 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... Excess solution was discarded and gel pieces were dried at room temperature for 30-45 min followed by an incubation at 4°C for 30 min with 20 µl 5 ng/µl trypsin (sequencing grade Promega, V5111) in 50 mM AHC ...
-
bioRxiv - Cell Biology 2020Quote: ... at 3500 cells/well and cell proliferation over 3-5 day periods was determined by measuring luminescence with CellTiter-Glo® assay kit (G7570, Promega), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: The crRNA (5’-AAUUUCUACUGUUGUAGAUGUGAUAAGUGGAAUGCCAUGUGGG-3’) was synthesized and purified using the T7 RiboMAX™ Express Large Scale RNA Production System (Promega). The following DNA templates were used for the in vitro transcription reaction ...
-
bioRxiv - Zoology 2024Quote: ... The amplicon target was amplified from WNV cDNA using the qPCR primers with the forward primer flanked by T7 sequence (5’-TAATACGACTCACTATAGGGATTCGGGAGGAGACGTGGTA-3’) and transcribed using T7 RiboMAX Express Large Scale RNA Production System kit (Promega, France). RNA was purified by ethanol precipitation ...
-
bioRxiv - Biophysics 2024Quote: ... labeling of TRPV1exCellHalo was completed in the imaging chamber by incubating cells with 3 μM Alexa660 Halo Ligand for 5 minutes (Promega, WI) in HBR followed by 3 minutes of continuous rinsing with HBR perfusion.
-
bioRxiv - Molecular Biology 2024Quote: ... the hdhfr positive selectable marker cassette was PCR amplified from the vector pL-6_eGFP(64) with primers hdhfr 5’ F and hdhfr 3’ R and cloned into pGEM-3Z (Promega, Madison, WI) digested with HincII ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA and 5% input were analyzed by qPCR using locus specific primers (Table 3) and SYBR Green Master Mix (Promega, A6002). IP DNA values were normalized to input using the following formula ...
-
bioRxiv - Molecular Biology 2023Quote: ... per manufacturer’s instructions using a GloMax 20/20 luminometer (Promega).
-
bioRxiv - Microbiology 2023Quote: ... luminescence was read using the 20/20 Glomax Luminometer (Promega). Luminescence readings taken for test samples transfected with pWTnsP1234 were normalised against readings for control samples transfected with pMUTnsP1234.
-
bioRxiv - Plant Biology 2024Quote: ... Luminescence was measured using the GloMax™ 20/20 (Promega), and relative luminescence values were calculated by normalizing to the control treatment ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl 5× Buffer (Promega), 2 μl MgCl2 (25mM) ...
-
bioRxiv - Biochemistry 2022Quote: The 4330bp PCR product amplified from M13mp18 by using primers: oM13-5-27 and oM13-3-24 was inserted into pGEM®-T Easy(PROMEGA #A137A). The resultant plasmid is named as pM13 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-goat alkaline phosphatase-linked antibody and alkaline phosphatase substrate (5-bromo-4-choloro-3-indolyl 1-phosphate and nitroblue tetrazolium) from Promega (Southampton, UK); a hydroxamate-based MMP inhibitor CT-1746 (N1-[2-(S)-(3,3-dimethylbutanamidyl)]-N4-hydroxy-2-(R)-[3-(4-chlorophenyl)-propyl]-succinamide ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... RBD-R: 5′-TGC CTC GAG CTC AAG TGT CTG TGGATC AC-3′) into pGEM T-easy vector (Promega, Madison, WI, USA). A standard curve was generated by determining the copy numbers derived from serial dilutions of the plasmid (103–109 copies) ...
-
bioRxiv - Cell Biology 2024Quote: ... the membranes were developed with a commercial solution of 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitro blue tetrazolium (NBT) according to the manufacturer (Promega, Madison, WI), in alkaline developing solution ...
-
bioRxiv - Biochemistry 2024Quote: ... GSK-3 (Promega), CK1 (Promega) ...
-
bioRxiv - Biophysics 2021Quote: ... using Promega GloMax 20/20 Microplate luminometer (Promega, Madison, WI, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc activity was measured in a GloMax 20/20 luminometer (Promega). Subsequently ...
-
bioRxiv - Biochemistry 2021Quote: ... Luminescence was measured using a GloMax® 20/20 luminometer (Promega).
-
bioRxiv - Biochemistry 2021Quote: ... and luminescence was measured on the GloMax-20/20 Luminometer (Promega). Data analysis was performed using GraphPad Prism 5.
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... FLuc activity was measured in a GloMax 20/20 luminometer (Promega). Subsequently ...
-
bioRxiv - Microbiology 2022Quote: ... on a luminometer (GloMax® 20/20 Luminometer, Promega, Madison, WI). Firefly luciferase was normalized against Renilla luciferase ...
-
bioRxiv - Biochemistry 2022Quote: ... following the manufacturer’s instructions with a GloMax 20/20 luminometer (Promega). The ratio of pHrD-IRES-luciferase/Renilla activity was calculated to control for transfection efficiency and normalized to the non-targeting control.
-
bioRxiv - Cancer Biology 2021Quote: ... on a Luminometer (GloMax® 20/20 Luminometer – Promega, Wisconsin, USA). ATP standard solutions (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... Bioluminescent signals were measured with a GloMax 20/20 luminometer (Promega). For the monitoring of NF-κB activity in Jurkat-NF-κB cells infected with HIV-1 ...
-
bioRxiv - Cell Biology 2022Quote: ... Luciferase activity was measured using GloMax-20/20 (Promega, Madison, WI). The transcriptional activity was expressed as the ratio of firefly:Renilla luciferase activity
-
bioRxiv - Immunology 2024Quote: ... Luminescence was measured using Glomax 20/20 luminometer (Promega, Madison WI). Luciferase activities were normalized with Renilla activities.
-
bioRxiv - Neuroscience 2023Quote: ... FLuc activity was measured with a GloMax 20/20 luminometer (Promega). Subsequently ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lysates were diluted 4-fold with 100 mM ammonium acetate and digested with sequence-grade trypsin (Promega) overnight at RT at an enzyme:substrate ratio of 50:1 (w/w) ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was isolated from cell pellets and culture supernatants cleared of cell debris by centrifugation of 5 min at 14000 rpm and treated with 20 U/ml DNase I (Promega, Madison, WI, USA) to remove free viral DNA ...
-
bioRxiv - Microbiology 2020Quote: ... followed by a reverse transcription using a universal degenerated oligo specific to all 5′ non-coding sequences of BTV-1 segments (BTV/Uni1; 5′ GTTAAAWHDB 3′) and the GoScript Reverse Transcription (RT) System (Promega, Madison, WI, USA). The cDNAs obtained for the segment 7 were then quantified with a real time quantitative PCR (qPCR) ...
-
bioRxiv - Cell Biology 2020Quote: ... washed again in DPBS and stained with 1mg/ml X-gal (5-bromo-4-chloro-3-indolyl-β-galactopyranoside, Promega, Madison, WI, US) in DMF (Dimetil formamide ...
-
bioRxiv - Immunology 2021Quote: ... CDC was measured after incubation for 3 hours at 37 °C 5% CO2 with a luminometer using the CytoTox-Glo Cytotoxicity Assay (Promega; Cat. Nr.: G9291) according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2023Quote: ... The amplicons generated from the 5’ and 3’ race PCRs were subjected to purification and subsequent cloning into the pGEM-T easy vector (Promega Corp., WI, USA). The constructed vectors were sequenced (Plasmidsaurus ...
-
bioRxiv - Microbiology 2023Quote: ... and the reaction was revealed with a solution of NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl-phosphate) (Promega, Madison, WI, USA).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Luminescence was measured using Glomax 20/20 luminometer (Promega, Madison, WI, USA). Luciferase activities (RLU ...
-
bioRxiv - Biochemistry 2021Quote: ... and 20 μL/well of a 1:20 dilution of BrightGlo (Promega,) in assay buffer supplemented with 0.01 % pluronic F68 (ThermoFisher ...