Labshake search
Citations for Promega :
151 - 200 of 3330 citations for 3 1H Pyrrol 1 yl phenyl methanol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Caspase-Glo 3/7 assay (Promega) was used according to the manufacturer’s manual ...
-
bioRxiv - Biophysics 2023Quote: ... and 3 µM CA-JF646 (Promega). Cells were then imaged at room temperature with a 60x objective (N.A ...
-
bioRxiv - Plant Biology 2024Quote: ... 3 µl of Trypsin gold (Promega, resuspended at 1 µg/µl in 50 mM Acetic acid ...
-
bioRxiv - Developmental Biology 2024Quote: ... and pAdVAntage (3 μg, Promega, E1711) using Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Caspase-Glo 3/7 Substrate (Promega) was added 1:1 to medium in triplicate wells and detected using a GloMax Luciferase Microplate Reader (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: Gently re-suspend cells in 100 μl of 3% Glyoxal fixation solution with 1:25 RNasin Plus (Promega N261B) and incubate for 15 minutes on ice.
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA was quantified to 3 μg to react 1 μg/μL random hexamer (C1181; Promega, Madison, WI, USA) at 70°C for 5 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Alkylation was quenched by the addition of 3 mM DTT and proteins were digested overnight at 37°C with 1 μg trypsin (0.5 μg/μl; Promega). Following digestion ...
-
bioRxiv - Cell Biology 2021Quote: ... Alkylation was quenched by the addition of 3 mM DTT and proteins were digested overnight at 37°C with 1 μg trypsin (0.5 μg/μl; Promega). Following digestion ...
-
bioRxiv - Biophysics 2022Quote: ... DTT was added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37 °C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were then transfected with plasmid DNA (4µg per plasmid per flask) using FuGENE HD (1:3 ratio; Promega) and cultured at 28°C.
-
bioRxiv - Cancer Biology 2023Quote: ... 170 µL medium was removed and 30 µL caspase 3/7 reaction (1:100 Z-DEVD-R110 fluorogenic substrate:Homogenous buffer; ApoONE, Promega) was added to each well ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were diluted 3 fold with 20mM HEPES pH 8.0 and digested in 10 @g ml-1 trypsin-TPCK (Promega) overnight at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CP4 medium was exchanged with Hanks’Balanced Salt Solution (with added glucose 1 g/l, NaHCO3 0.35 g/l) containing GloSensor cAMP Reagent (3 %, Promega) and plates were incubated for 60 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... Transfection solutions were made at a lipid (µg) to plasmid (µL) ratio of 3:1 using FuGene 6 (Promega) as the transfection reagent ...
-
bioRxiv - Cancer Biology 2024Quote: Purified rRNA (1 to 3 µg) was digested overnight at 37 °C with 270 units of Nuclease S1 (Promega) using the supplied buffer ...
-
bioRxiv - Immunology 2024Quote: ... and 1μg of plasmid expressing the respective spike protein using a 3:1 ratio of Fugene HD transfection agent (Promega).28,49 After 48 hours of incubation at 10% CO2 ...
-
bioRxiv - Biochemistry 2021Quote: The activity of Caspase 3/7 was determined using the Caspase-Glo® 3/7 Assay (Promega). Upon incubation of the cells with the different treatment regimens ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cleavage of Caspase 3 and 7 was quantified by using Caspase-Glo 3/7 Assay System (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... caspase-3/7 activity was determined using the Apo-ONE® homogeneous caspase-3/7 assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... gDNA was amplified using primers 5’-AGTCCCTTCCTTGTCACTTAGT-3’ and 5’-ATCTCACAAGAAAGCGAAATCC-3’ and GoTaq DNA Polymerase (Promega), then digested using EcoRV (New England Biosciences) ...
-
bioRxiv - Microbiology 2024Quote: ... Caspase 3/7 activity was then quantified using the Apo-One Homogenous Caspase-3/7 assay (Promega).
-
bioRxiv - Cancer Biology 2023Quote: ... The primer pair (5′- accagacggagtttgagcgcgtcttcTGAGGAGGATCCGGTGGAGCTAGCGGAAGA-3′ and 5′-ctccaccgagtcgtactgcttcgccatACCAGAATTCCCACCGCTCGAGCCA-3′) and pBit3.1-N (Cat. No. N2361, Promega) were used to clone the vector-containing fragment ...
-
bioRxiv - Cancer Biology 2023Quote: ... Caspase-3 and -7 activities were measured using the Caspase-Glo 3/7 assay kit (Promega, G8090) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Caspase 3/7 activity was measured using the Caspase-Glo® 3/7 Assay System (G8090, Promega) per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... using primers 5’-TCCCTTCCTTCAAGGCTACA-3’ and 5’-GTTAGGAGCCAGAGCAGCAC-3’ and the Go-Taq Flexi DNA Polymerase (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Pro-apoptotic caspase 3/7 activation was measured using the Caspase-Glo 3/7 Assay Kit (Promega). Worms (pools of 5 male and 5 female worms ...
-
bioRxiv - Neuroscience 2024Quote: ... Caspase 3/7 activity was determined using the Caspase-Glo 3/7 Assay (Promega, Madison, WI, USA). Reconstituted Caspase-Glo 3/7 reagent was added to the cells 24 h post-transfection ...
-
bioRxiv - Bioengineering 2024Quote: ... Analysis of caspase-3/7 was performed by using the Caspase-Glo® 3/7 Assay (Promega). An equal volume of reagent was added and gently mixed at 37 °C for 2 hours according to the manufacture’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... the caspase 3/7 assay was done using the Caspase-Glo 3/7 Assay System (Promega, G8092) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... free thiols were alkylated by iodoacetamide and proteins were sequentially digested with endoproteinase Lys-C (Wako, 1:100 enzyme-to-substrate ratio, 3 h at 37 °C) and trypsin (Promega, 1:50, overnight at 37 °C). Digested samples were desalted ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL RRV-P3 plasmid or 3 μL of cDNA from rose tissue or nuclease-free water (Promega, Madison, WI). The final volume of the LAMP reaction was 25 μL.
-
bioRxiv - Immunology 2021Quote: ... JEG-3 viability after 1 h salubrinal pretreatment followed by 48 h ZIKV infection was measured by CellTiter-Glo Assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The cells were then washed three times with 1 × PBS and blocked with 3% Blot-Qualified bovine serum albumin (BSA, Promega) in 1 × PBS containing 0.05% Tween-20 (TPBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the pSARP-12R4-9 input library with a 3:1 transfection reagent:DNA ratio using Fugene 6 transfection reagent (Promega #E269A). At 72 hrs ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA-TBST for 1h at room temp ...
-
bioRxiv - Molecular Biology 2022Quote: ... The SELENOP 3’UTR and the control plasmid were linearized using Bsb 1 and in vitro transcribed using the Ribomax kit (Promega). The RNA was then purified using p30 size exclusion columns (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... the HSV-1 ICP0 3’UTR was amplified from pICP0(HSV-1) using psiV1ICP0UTRf and psiV1ICP0UTRr primers and inserted into psiCHECK-2 (Promega). psiChHVICP03UTR was constructed by inserting the synthesized ChHV ICP0 3’ UTR into the same position ...
-
bioRxiv - Microbiology 2021Quote: ... The cytotoxicity of compounds (100 uM to 1 uM, 3-fold dilution) was examined using the CellTiter-Glo Luminescent Cell Viability Assay (Promega). Cell cytotoxicity data was normalized to DMSO control as 0% cell death.
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were washed 3 times for 10 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 5% non-fat dry milk -TBST for 1 h at RT ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...