Labshake search
Citations for Promega :
151 - 200 of 3301 citations for 1 Bromo 3 difluoromethoxy benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were washed 3 times for 10 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 5% non-fat dry milk -TBST for 1 h at RT ...
-
bioRxiv - Genomics 2024Quote: ... Reverse transfection was done using a ratio 3:1 volume-to-mass ratio of FuGENE6 (0.3 µL reagent: 100 ng of DNA per well, Promega E2691). The transfection mix included the following vectors ...
-
bioRxiv - Cell Biology 2024Quote: ... protein samples were then incubated with chymotrypsin at a ratio of 1:80 (enzyme to protein) for 3-4 h at RT and then trypsin (Promega) at a ratio of 1:80 (enzyme to protein ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were seeded onto acid-washed coverslips to ensure surface cleanliness and cell adherence at a density of 3 × 104 cells per coverslip for 24 h before transfection with 1 μg of plasmid DNA using 3 μL Fugene HD transfection reagent (Promega). HaloTagged AP2-σ2 was visualized by adding the JF646-HaloTag ligand (Promega) ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated ∼18 hours at 37°C and individual white colonies screened for insert by colony PCR using primers M13_F (5’-ACGACGTTGTAAAACGACGGCCAGT-3’) and M13_R (5’-ATTTCACACAGGAAACAGCTATGACCA-3’) GoTaq DNA Polymerase (Promega). Reactions were separated by gel electrophoresis ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) (Promega, Cat. No. G109C) cell viability assay was performed ...
-
bioRxiv - Physiology 2022Quote: Caspase 3/7 activity was determined using the Caspase-Glo® 3/7 assay (Promega, Madison, WI, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Caspase 3 and/or 7 activity was assessed with Caspase-Glo 3/7 assay purchased from Promega (G8090).
-
bioRxiv - Immunology 2020Quote: ... the Caspase 3/7 activity of hemocytes was determined with the Caspase-Glo 3/7 assay (Promega, USA). While the apoptosis rate was evaluated using FITC Annexin V Apoptosis Detection Kit I (BD PharmingenTM ...
-
bioRxiv - Genetics 2022Quote: ... The DNM1 amplification was performed with specific primers pair (DNM1_Forward 5’-GGGTCTTGTACGGAGCAGGG-3’ and DNM1_Reverse 5’-GAGTCAGATAGTAAGGGCAAGCAC-3’) using Pfu DNA polymerase (Promega). After the first amplification to select DNM1 fragment of 761 bp ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Caspase 3/7 activity was determined using the Caspase-Glo® 3/7 assay (Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Caspase 3/7 activities in were assessed by using Caspase-Glo 3/7 assay (Promega Corp., Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Caspase-3/7 activity in leukemia cells were detected by Caspase-Glo 3/7 Assay System (G8091; Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: Caspase 3/7 activity was determined using the Caspase-Glo 3/7 Assay Kit (Catalog No. G8091, Promega) for each sample according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Caspase 3/7 activity was determined using the Caspase-Glo® 3/7 assay (Promega, Madison, WI, USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... the MTS solution (3-(4,5-dimethylthiazol-2-yl)-5-(3- carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) (Promega # G3581) was added to individual wells ...
-
bioRxiv - Molecular Biology 2024Quote: ... Caspase-3/7 was quantified using the Apo-ONE® Homogeneous Caspase-3/7 Assay (Promega, Fisher scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Caspase 3/7 Glo (Promega #G8091) were added and assayed according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 μL of Cell Titer Glo (Promega) were added to each well ...
-
Targeted degradation of PCNA outperforms stoichiometric inhibition to result in programed cell deathbioRxiv - Cell Biology 2022Quote: ... For the Caspase 3/7 Glo (Promega) assay ...
-
bioRxiv - Biochemistry 2020Quote: ... and Caspase-Glo 3/7 assay (Promega), respectively ...
-
bioRxiv - Zoology 2021Quote: ... and 3% 20mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact.
-
bioRxiv - Cell Biology 2022Quote: ... We added 3 μg Trypsin Gold (Promega) to each sample for digestion and incubated samples at 37°C overnight (approximately 16 hours ...
-
bioRxiv - Microbiology 2022Quote: ... 3 μL of dNTPs (20mM, Promega®), 5 μL of buffer (5x ...
-
bioRxiv - Microbiology 2022Quote: ... 3 μL of dNTPs (20mM, Promega®), 5 μL of buffer (5x ...
-
bioRxiv - Cancer Biology 2022Quote: ... The Caspase-Glo 3/7 Assay (Promega) was performed according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: A caspase - Glo 3/7 kit (Promega) was used to evaluate caspase 3/7 activity based on the kit protocol ...
-
bioRxiv - Zoology 2020Quote: ... and 3% 20mg/ml Proteinase K (Promega). Many additional photos of spicules and sections are available in the supplementary data that accompanies this paper ...
-
bioRxiv - Genetics 2020Quote: ... 3 μl of RNasin ribonuclease inhibitor (Promega) per ml of extraction buffer] ...
-
bioRxiv - Microbiology 2024Quote: ... the Caspase-Glo-3/7 kit (Promega) was used as previously described (22) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl MgCl 25 mM (Promega A3511), 0.2 mM dNTPs ...
-
bioRxiv - Cancer Biology 2023Quote: ... by Caspase-Glo 3/7 assay (Promega), were assessed using manufacturer’s instructions ...
-
bioRxiv - Zoology 2024Quote: ... and 3% 20mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 ul of RNasin Ribonuclease Inhibitor (Promega) was added to the beads and incubated for 2 hours at 4°C/3rpm ...
-
bioRxiv - Cell Biology 2023Quote: ... Caspase-Glo® 3/7 reagent (Promega) was added to each well as per manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: ... For SUMO1-3 thrombin (16 U; Promega) was used for cleavage in buffer (20 mM Tris-HCl pH 8.4 ...
-
bioRxiv - Zoology 2022Quote: ... and 3% 20mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact ...
-
bioRxiv - Molecular Biology 2024Quote: ... Caspase-Glo 3/7 luciferase substrate (Promega) was added in a 1:1 ratio to each well followed by gentle shaking for 30 s ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μL of FuGeneHD (Promega Cat# E2311) was added and incubated for an additional 15 min ...
-
bioRxiv - Cancer Biology 2024Quote: The Caspase-Glo 3/7 Assay (Promega) was used to measure apoptosis in meningioma cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... Caspase-Glo 3/7 3D (Promega, G8981) was used to analyze A375 spheroid apoptosis induced by different treatments.
-
bioRxiv - Cancer Biology 2022Quote: ... caspase-3 and caspase-7 activities were measured using a Caspase Glo 3/7 Assay (G8090; Promega, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: The activity of caspase-3/7 was measured by Caspase-Glo-3/7 assay kit according to the manufacturer’s instructions (Promega). Cell death was assessed by an Annexin-V FITC binding assay (Miltenyi ...
-
bioRxiv - Biochemistry 2021Quote: Caspase-3/7 activity was quantified by fluorometric assay using ApoONE Homogeneous Caspase-3/7 Assay Kit (Promega, US). AU565 cells ...