Labshake search
Citations for Promega :
1901 - 1950 of 5423 citations for Mouse Protein Jagged 2 JAG2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... with a GoTaq® qPCR master mix kit (Promega). We used two technical replicates for each biological replicate ...
-
bioRxiv - Developmental Biology 2019Quote: ... Luminescence was measured following the kit protocol from Promega.
-
bioRxiv - Biochemistry 2020Quote: ... The pGEM-T Vector kit was purchased from Promega. Acrylamide/bisacrylamide (29:1 ...
-
bioRxiv - Microbiology 2019Quote: ATP was estimated using the BacTiter-Glo kit (Promega). For BDQ or INH treatments in MMA ...
-
bioRxiv - Cell Biology 2019Quote: ... and subsequently analyzed using the GoTaq Green kit (Promega) for analytical RT-PCRs with the primers listed in the Key Resources Table ...
-
bioRxiv - Molecular Biology 2019Quote: ... Maxwell RSC DNA FFPE Kit (Promega Maxwell® RSC), PerkinElmer chemagic FFPE DNA kit (chemagic MSM 1 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... using the Wizard® Genomic DNA Purification Kit (Promega). The kit can be used for at least 100 isolations ...
-
bioRxiv - Genetics 2019Quote: ... using in situ DeadEnd Fluorometric detection kit (G3250-PROMEGA) according to technical protocol (#TB235) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using the Maxwell 16 LEV Plant DNA Kit (Promega), with EcoR1 as the restriction enzyme for generating RAD-seq libraries ...
-
Cytoplasm localized ARID1B promotes oncogenesis in pancreatic cancer by activating RAF-ERK signalingbioRxiv - Cell Biology 2019Quote: Halo tag (Halo pulldown and labeling kit, Promega Corporations) and Streptavidin bead (GE Health care Bio-Science ...
-
bioRxiv - Cancer Biology 2019Quote: ... The dual luciferase assay kit (Promega, Madison, WI, USA) and Glomax 96 Microplate Spectrophotometer (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... Luciferase activity was measured by luciferase assay kit (Promega) using an LMaxII™ microplate luminometer (Molecular Devices) ...
-
bioRxiv - Cancer Biology 2021Quote: FGFR1 kinase enzyme system kit was purchased from Promega Inc ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell lines were authenticated using the GenePrint10 kit (Promega) and matching to their original profiles (ATCC) ...
-
bioRxiv - Cell Biology 2021Quote: ... we used the CellTiter-Glo® Luminescent kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Neutralization was measured with a luciferase assay kit (Promega) and plotted relative to the value for control wells.
-
bioRxiv - Plant Biology 2020Quote: ... or Maxwell® 16 LEV Plant RNA Kit (Promega). cDNA was synthesized using Primescript II 1st Strand cDNA Synthesis Kit (Takara ...
-
bioRxiv - Plant Biology 2021Quote: ... using the Maxwell 16 LEV Plant RNA Kit (Promega). RNA was quantified using a NanoDrop (Thermo Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using MMLV reverse transcriptase kit (Promega) according to the manufacturers’ protocol with random primers (Promega) ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was extracted using the Wizard Kit (Promega), as stated above ...
-
bioRxiv - Microbiology 2021Quote: ... The Wizard genomic DNA purification kit (Promega, Madison, WI) was used for isolation of bacterial genomic DNA (gDNA) ...
-
bioRxiv - Cell Biology 2020Quote: A GenePrint 10 System PCR Amplification kit (Promega Corporation) was used to determine the genetic signature of both samples based on the multiplex analysis of 9 loci and the Amelogenin sex-determining marker ...
-
bioRxiv - Cancer Biology 2019Quote: ... Dual-luciferase reporter gene assay kit (Promega, Beijing, China) was used to measure activities of Luciferase ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA synthesised (AMV Reverse Transcriptase kit, Promega, Southampton, UK) and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC ...
-
bioRxiv - Microbiology 2022Quote: ... with the Maxwell® RSC Blood DNA kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: Cell Titer Glo Luminescent Cell Viability Assay Kit (Promega) was used and subsequently performed after the BRET measurement ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized using the reverse transcription kit (Promega) and transcriptional expression of IFIT1 (Fw ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA synthesis was done with reverse transcription kit (Promega) using 50ng of total RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the Maxwell DNA LEV Blood Kit (Promega #AS1290) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... purified using a Wizard Genomic DNA Purification kit (Promega), and sent for Sanger sequencing (ACGT) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Triglyceride-Glo™ Assay kit (Cat#J3160, Promega) from Promega were used according to user’s manual ...
-
bioRxiv - Microbiology 2019Quote: ... coli S30 Extract system for Linear Templates kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2019Quote: Wizard Genomic DNA purification kit (Promega, Madison, WI, USA) (Catalog NO. ...
-
bioRxiv - Immunology 2019Quote: ... and Caspase-Glo® 3/7 assay kit (Promega). A volume of 100 μL cells was placed in a 96-well plate ...
-
bioRxiv - Physiology 2019Quote: ... cDNA was synthesized using a Reverse Transcriptase kit (Promega). Quantitative real-time PCR was conducted using primer sets in Supplementary Table 1 and mRNA levels were analyzed in duplicate using SYBR green (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell viability was determined using the CellTiterGlo kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and purified with the Wizard SV Gel kit (Promega). The purified DNA was incubated with DpnI (New England BioLabs® ...
-
bioRxiv - Cancer Biology 2019Quote: ... Luciferase activities were measured with Luciferase assay kit (Promega) and were normalized with protein concentrations of samples.
-
bioRxiv - Genetics 2021Quote: ... using the Maxwell 16 Tissue DNA Purification kit (Promega). The ddRAD-seq library was constructed using all the genomic DNAs according to the method described in Peterson et al ...
-
bioRxiv - Plant Biology 2020Quote: ... The GoTaq qPCR Master Mix Kit (Promega Corporation, USA) was used for the gene expression profiling ...
-
bioRxiv - Microbiology 2021Quote: ... In vitro transcription reactions (Promega MegaScript T7 transcription kit) containing ∼400 ng of the purified PCR product ...
-
bioRxiv - Molecular Biology 2019Quote: ... Viability was determined using the CellTiter-Glo Kit (Promega) as per manufacturer’s recommendations ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Luciferase expression was measured using the DualGlo Kit (Promega). Firefly luciferase signal was normalized to Renilla luciferase signal in each well ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... the LDH CytoTox 96 kit from ProMega (Madison, WI), Urea Nitrogen Test from StanBio Laboratory (Boerne ...
-
bioRxiv - Molecular Biology 2019Quote: ... the plasmid was recovered using a miniprep kit (Promega), DpnI digested and transformed into MBM7070 indicator bacteria ...
-
bioRxiv - Microbiology 2021Quote: ... we used the CellTiter-Glo® Luminescent kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... cAMP-Glo™ Assay kit (Promega, Cat. no. V1501) was used to measure cellular cAMP levels via GloMax® Discover Microplate Reader (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... with Maxwell® RSC simplyRNA Tissue Kit (AS134, Promega), following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell lines were either fingerprinted (PowerPlex 1.2 Kit, Promega) or independently authenticated annually (ATCC ...
-
bioRxiv - Microbiology 2021Quote: ... or Maxwell 16 LEV simplyRNA cell kit (Promega; #AS1270), respectively ...