Labshake search
Citations for Promega :
1751 - 1800 of 4405 citations for Mouse Vasoactive intestinal polypeptide receptor 2 VIPR2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: Viable cell numbers were quantified either by Trypan blue exclusion or by the production of formazan product (OD490) 2 hours after addition of CellTiter 96® Aqueous One Solution assay reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... the final volume was brought to 80 ml with Lysis Buffer+2 mM CaCl2 and incubated with 1000U of RQ1 DNase (Promega-PRM6101) for 30min at RT ...
-
bioRxiv - Genomics 2021Quote: ... 23.5 μl PCR master mix (20 μl Buffer 5X, 2 μl dNTPs 10 μM, 1.5 μl GoTaq; Promega, cat. no. M3001), and 5 μl of Forward universal primer ...
-
The human sperm basal body is a complex centrosome important for embryo pre-implantation developmentbioRxiv - Developmental Biology 2021Quote: ... The resulting protein extract was first diluted to 2M urea for overnight digestion with LysC (Wako, USA) at 37°C and then diluted 2-fold for 8 h digestion with trypsin (Promega, USA) at 37°C.
-
bioRxiv - Developmental Biology 2022Quote: ... for the duration of imaging (approximately 2 minutes per embryo) with the yolk supported in a shallow well of solidified 1% low-melting agarose (Promega, V2111). Adult fish were photographed using a Panasonic DMC GX7 camera with a Panasonic Lumix G 20mm pancake lens ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... HEK293T cells were transiently transfected using Lipofectamine 2000 with 50 ng each of GLP-1R-SmBit and LgBit-β-arrestin-2 (Promega) diluted in pcDNA3.1 ...
-
bioRxiv - Microbiology 2022Quote: Various KSHV mRNA 5’-UTRs containing uORFs were cloned up stream of the Renilla luciferase gene in a psiCHECK™-2 vector (Promega) using a Gibson Assembly® Cloning Kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... 2 × 106 cells of each strain were mixed completely with equal volumes of the BacTiter-Glo reagent (Promega Corporation, Madison, WI), followed by incubation at room temperature for 15 min in the dark ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were incubated at 30 °C and luminescence was quantified after 2 h and 4 h post infection (20 μl sample plus 20 μl substrate, Nano-Glo® Luciferase Assay System, Promega). The sample was carefully removed from the upper part of the tube without disturbing the sedimented erythrocytes in the blood samples.
-
bioRxiv - Synthetic Biology 2022Quote: To measure luciferase activity on plaque containing LB-agar plates, 5 μl of the diluted (1:50, in PBS) NanoLuc® luciferase substrate 2-furyl methyl-deoxy-coelenterazine (Furimazine; Promega) were dropped onto the respective plaques ...
-
bioRxiv - Immunology 2023Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113). After digestion ...
-
bioRxiv - Immunology 2023Quote: ... reverse primer – GCTTCATCTCAACCTCCGTC) using genomic DNA from monocytes and ligated in dual luciferase reporter vector psiCHECK-2 downstream of Renilla luciferase (Promega Corporation) vector in Xho1 and Not1 sites in MCS ...
-
bioRxiv - Microbiology 2023Quote: The assay was adapted from 15 where Hyp1-Nluc schizonts at 1% hematocrit and 1-2% parasitaemia were lysed in 1x NanoGlo buffer (Promega, USA) within a 96-well flat-bottom plate and parasite lysates were added to compounds and incubated for 10 minutes at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was stopped with the addition of 150 µL IP Elution Buffer (1% SDS, 0.1 M NaHCO3) and 2 µL Proteinase K (Promega, Cat # MC5005), then incubated at 65 °C overnight to reverse crosslinks ...
-
bioRxiv - Biophysics 2023Quote: ... transfection was carried out by adding 2 μg of freshly prepared bacmid DNA and 6 μL of FuGene HD transfection reagent (Promega, E2311), following the instructions provided by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μL of furimazine substrate was added to the reaction well from a working reagent stock of a 2:100 NanoDLR Stop & Glo Substrate to Buffer ratio (Promega #N1610). A total well volume of approximately 112.5 μL was incubated at room temperature for 2 minutes prior to measuring luminescence and OD600 readings on an EnVision plate reader (PerkinElmer).
-
bioRxiv - Microbiology 2023Quote: The viral RNA derived from the lung and nasal turbinate samples was quantified using a protocol for quantifying the SARS-CoV-2 sub-genomic E gene RNA (sgE)29 using the GoTaq® Probe 1-Step RT-qPCR System (Promega).
-
bioRxiv - Cell Biology 2023Quote: ... the 200k pellets were digested for 2 h at 37°C with 0.4 µg of Trypsin/Lys-C (Promega CAT#: V5071) and then overnight by adding 0.4 µg of Trypsin/Lys-C ...
-
bioRxiv - Genetics 2023Quote: ... After adding 2 µg MS grade trypsin in the intraspecific hybrids (Pierce Biotechnology, Waltham, MA) and polyploids (Promega Corporation, Madison, WI) to each sample ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 µg of bacmid DNA were used to transfect Sf21 cells for baculovirus generation using FuGENE® transfection reagent (Promega). The protein was expressed in Lonza Insect-EXPRESS™ medium for 72-96 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Levels of reporter mRNAs in eggs were measured 6 hrs post-injection by RT-qPCR using the GoTaq 2-Step RT-qPCR system as per manufacturer’s instructions (Promega, Madison, WI) with random primers for reverse transcription and oligos listed in Table 1 for the qPCR step.
-
bioRxiv - Genomics 2023Quote: ... The reaction was stopped with the addition of 150 μL IP Elution Buffer (1% SDS, 0.1 M NaHCO3) and 2 μL Proteinase K (Promega, Cat # MC5005), then incubated at 65 °C overnight to reverse crosslinks ...
-
bioRxiv - Microbiology 2023Quote: ... for 2 hours at 72 hours and lysed at 98 hours using 25 μl Dual-Glo® Luciferase Assay System (Promega). Luminescence was measured ...
-
bioRxiv - Immunology 2024Quote: ... Quantification of SARS-CoV-2 RVP infection was determined using the Renilla-Glo® luciferase assay system (Promega Corp., Madison, WI). Microtiter assay plates were centrifuged for 5 min at 2000 rpm to prevent cell loss ...
-
bioRxiv - Immunology 2024Quote: ... mice were humanely killed by xylazine/ ketamine overdose and lungs inflated with 1 ml of 2% low melting temperature agarose (Promega, US) at 37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were then washed 3x with TBS-T and incubated for 2 hours at room temperature with either anti-rabbit (1:5000, Promega W4011) or anti-mouse HRP (1:5000 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... the treatment was removed from the wells and the cells were incubated with 100 μl of EGM™-2 complete medium with 20 mM HEPES and 20 μl of MTS (Promega, CellTiter 96® AQueous One Solution Reagent ...
-
bioRxiv - Neuroscience 2024Quote: ... Peptide digestion was initiated by adding 25 µL of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 µg trypsin (Sequencing Grade Modified Trypsin, Promega, # V5117) directly on top of the column and incubating overnight at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... short tandem repeat analysis verified the identity of mouse (Bioassay Methods Group, National Institute of Standards and Technology) and human (Promega GenePrint 10 System) cells.
-
bioRxiv - Cell Biology 2022Quote: ... blots with α-PRDX6 and α-PfNAPL were incubated with respective α-mouse and α-rabbit horse radish peroxidase (HRP)-coupled secondary antibodies (1:5000, Promega) for 1h at RT ...
-
bioRxiv - Molecular Biology 2019Quote: ... incubated with anti-mouse or anti-rabbit HRP-conjugated secondary antibody for 30min (anti-mouse IgG HRP conjugate Promega #W402B, anti-rabbit IgG HRP conjugate Promega #W4011, 1:3000) and chemiluminescence was detected using Western Bright ECL spray (Advansta ...
-
bioRxiv - Plant Biology 2022Quote: ... as primary antibodies and anti-mousse IgG-HRP conjugated secondaries antibodies (Mouse IgG, HRP conjugate W402B, Promega; 1/5000 in TBST, 4 hours). As a loading control we used anti-tubulinα antibodies as primary antibodies (1/1000 in 5 % milk over-night) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Then wells were washed again three times with PBS-T (100 μl per well) and incubated with a secondary mouse-HRP antibody (goat, Promega, Madison, WI, USA) (50 μl per well ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subsequent to primary antibody removal chitin magnetic beads were washed three times with PBS-T and incubated with secondary mouse-HRP antibody (goat, Promega, Fitchburg, United States) 1:5000 in 100 μl sample buffer on a stirring wheel at room temperature for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... the strips were washed in TBS-T for 15 min and incubated with the secondary antibody anti-mouse IgG-HRP (Promega, Cat. no: W4028) at 1:10000 dilution in TBS-T 3 % BSA for 1h ...
-
bioRxiv - Microbiology 2020Quote: PKA activity (PepTag® Non-Radioactive Protein Kinase Assay kit V5340, Promega) was carried out according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Viral DNA was then extracted using a Wizard DNA purification kit (Promega) with 1 ml resin to 0.5 ml sample ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA was prepared using the Wizard Genomic DNA purification kit (Promega) and culture aliquots were frozen at −80°C for storage in 10% DMSO ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative real-time PCR was performed using the SYBR premix kit (Promega), and the primer sequences used are listed in Supplemental Table S2 ...
-
bioRxiv - Cell Biology 2020Quote: ... and firefly luciferase analyzed using the Dual-Glo Luciferase assay kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Cell viability was measured with a tetrazolium-based toxicology assay kit (Promega). CHO cells (1 × 104 cells per well ...
-
bioRxiv - Microbiology 2020Quote: Luciferase assays were performed with the Nano-Glo Luciferase Assay kit (Promega). Mouse fecal pellets were collected in 1.7 ml microcentrifuge tubes ...
-
bioRxiv - Molecular Biology 2022Quote: ... The RNA was extracted with the Maxwell RSC Plant RNA Kit (Promega) and was further DNase-treated with the TURBO DNA-free Kit (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... was assessed using a CellTiterGlo® 2.0 kit (Promega, Fitchburg, Wisconsin, USA) on a TECAN spark microplate reader (Tecan Trading AG ...
-
bioRxiv - Microbiology 2022Quote: ... and FLuc activity was assayed using the Dual Reporter Luciferase kit (Promega).
-
bioRxiv - Neuroscience 2021Quote: ... which was carried out by luminescent Promega ENLITEN ATP kit (Promega, USA). Data were calculated as pmol ATP / mg protein and expressed as percentage of control.
-
bioRxiv - Molecular Biology 2020Quote: RNA extraction and DNAse treatment was performed using Maxwell simplyRNA kit (Promega) or RNeasy Mini kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... TUNEL assays were performed with DeadEnd™ Fluorometric TUNEL System kit (Promega) as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: TUNEL assays were performed using DeadEnd™ Fluorometric TUNEL System kit (Promega) as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: Luciferase reporter assays were carried out using Dual-Luciferase Assay Kit (Promega), following the manufacturer’s instructions ...