Labshake search
Citations for Promega :
1751 - 1800 of 1911 citations for AKT1 2 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... cells were starved by 50 μL Hank’s balanced salt solution for 30 min and then incubated in 50 μL CO2-independent media containing 2% GloSensor cAMP Reagent (Promega) for 1 hour ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 × 106 Sf9 cells in 2 mL of media in a 6-well dish were transfected with up to 2 µg of fresh bacmid DNA using FuGene HD transfection reagent (Promega) at a ratio of 3:1 (Fugene reagent:DNA ...
-
bioRxiv - Microbiology 2023Quote: ... Specific adapters 1 and 2 described in Table B were self-hybridized and then ligated to the ‘A’ tail ends by T4 ligase (Promega). After purification with AMPure XP purification kit (Agencourt) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 mM KCl, 5 mM MgCl2, 2 mM DTT, 100 μg ml-1 cycloheximide, and 20 U ml-1 RNase inhibitor [Promega].) Gradients were centrifuged 36,000 rpm for 2.5 h in a SW41 Ti rotor (Beckman Coulter ...
-
bioRxiv - Biochemistry 2023Quote: ... proteins were diluted with 50 mM NH4HCO3 to a final concentration of 2 M urea and digested with trypsin (Promega), at an enzyme-to-substrate ratio of 1:20 ...
-
bioRxiv - Neuroscience 2023Quote: ... luminescence photons were collected by accumulating the image for 60 s in the presence of 2 mM D-luciferin (Promega), and the luminescence signal was measured from the same varicosities as the corresponding fluorescence image ...
-
bioRxiv - Biochemistry 2023Quote: ... then washed and resuspended in 2 M urea and trypsinized overnight with 0.5 μg/μl sequencing grade trypsin (Promega, V5111). Tryptic peptides were eluted off with spin columns (BioRad ...
-
bioRxiv - Cancer Biology 2023Quote: ... First-strand complementary DNA (cDNA) synthesis was performed using 2 μg of total RNA with M-MLV reverse transcriptase (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... and the corresponding SARS-CoV-2 spike construct were co-transfected in HEK293-T cells using FuGENE 6 Transfection Reagent (Promega) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Cancer Biology 2023Quote: The activity of EBV miRs-BART 7-3p and 9-3p was evaluated in Akata-EBV/Cas9 cells by luciferase reporter gene assay with constructs based on the psiCheck-2 backbone (Promega). 3’-UTR sequences with miRNA-binding sites (Supplementary Material ...
-
bioRxiv - Molecular Biology 2023Quote: ... siRNAs were detected with a YFP long probe (primers listed in Supplemental Table 2) labeled with 32P-dCTP prepared according to the manual of the Prime-a-Gene Labeling System (Promega). The blot was hybridized overnight at 42 °C with the probe before being washed with 2xSSC ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100, 2 mM DTT, 100 μg ml-1 cycloheximide [Sigma], 20 U ml-1 RNase inhibitor [Promega] ...
-
bioRxiv - Microbiology 2023Quote: ... injecting 50 μl per well of coelenterazine substrate (Nanolight Technologies, 2 μg/ml) and analysing luminescence on a FLUOstar OPTIMA luminometer (Promega). Fold inductions were calculated by normalising to a mock-treated control.
-
bioRxiv - Evolutionary Biology 2023Quote: ... reverse transcription was performed using Promega’s Go-Taq 2-Step system with oligo(dT) and randomized primers as per manufacturer’s instructions (Promega, Madison, WI).
-
bioRxiv - Plant Biology 2023Quote: ... Purified DNA was run on 2% agarose gel and bands corresponding to ∼150 bp were cut and purified with a Gel Purification kit (Promega). Libraries were constructed using the Nugen Ovation Ultralow Library System V2 following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... gondii glyceraldehyde 3-phosphate dehydrogenase 2 (GAPDH2, ML5049/ML5680) or TgAPT1 (ML4097/ML4098) were used for subsequent PCR amplification with GoTaq polymerase (Promega) for twenty-five cycles as follows ...
-
bioRxiv - Microbiology 2023Quote: Vero E6 cells were transfected with an GFP expression vector together with either a control expression vector (no spike) or a SARS-CoV-2 spike expression vector using Fugene (Promega). Two hours after transfection ...
-
bioRxiv - Systems Biology 2023Quote: ... The panel of ssDNA-labelled antibodies (250 ng/ml for each antibody) was mixed with 2 U/µl RNAsin Plus (Promega) and 0.1% Triton X-100 in PBS:PFBB (1:1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR fragment was directionally cloned downstream of the Renilla luciferase ORF in the psiCHECK-2 vector (Promega, Madison, US) using the Quick Ligase kit (M2200 ...
-
bioRxiv - Neuroscience 2023Quote: ... Blots were then incubated with blotting buffer containing 1:200 LgBiT for 1-2 h with rocking at RT (N2410, Promega). Next ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with 4% FBS and 100 µL were seeded per well in 96-well plates at a density of 2×105 cells/mL in the presence or absence of 0.1 mM HaloTag NanoBRET™ ligand (Promega). The following morning ...
-
bioRxiv - Biochemistry 2023Quote: ... pLH3/DTX3L or pLH3/DTX3LΔN) and accessory plasmids pMD2g and psPAX2 (ratio 2:1:1) using ViaFect transfection reagent (Promega E498A). After cell incubation at 37°C for ∼16 h ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated from 20-100 ng of RNA using the GoTaq 2-step RT-qPCR System (Promega, cat# A6110). qPCR was performed with SYBR Green on a StepOnePlus real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2023Quote: ... lysyl endopeptidase (Wako) at 25°C for 2 hours followed by another overnight digestion with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Neuroscience 2023Quote: ... lysyl endopeptidase (Wako) at 25°C for 2 hours and further digested overnight with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Microbiology 2024Quote: ... Tat and Rev and plasmid encoding spike of SARS-CoV-2 variants Delta or Omicron were transfected in HEK 293T cells using Fugene6 reagent (Cat. No. E2691, Promega) following manufacturer’s guidelines ...
-
bioRxiv - Pathology 2024Quote: ... The samples were diluted with 50 mM TEAB buffer to a final Urea concentration of 2 M before adding trypsin (Promega) in an enzyme:substrate ratio of 1:75 and incubating at 25 °C for 16 hours ...
-
bioRxiv - Neuroscience 2024Quote: ... diluted by 4-fold to reduce urea to 2 M for the addition of trypsin (Promega, 1:50 w/w) to continue the digestion at 21ºC overnight ...
-
bioRxiv - Immunology 2024Quote: ... 48 hours later the media was removed and replaced with 25 µL of RMPI-1640 media supplemented with 2% low-IgG FBS (Promega). Antibodies were serially diluted 1:10 in RPMI 1640 media from a starting concentration of 30 µg/mL to a final concentration of 0.014 µg/mL and 25 µL of antibody dilution was added to the plate ...
-
bioRxiv - Cell Biology 2023Quote: ... dilute with 4 volumes of 20 mM Tris-HCl pH8 / 2 mM CaCl2 before overnight digestion at room temperature with 100 ng sequencing grade trypsin (Promega). Samples were centrifuged ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cells were pre-incubated in Hanks’ balanced salt solution with increasing concentrations of compound for 60 minutes before stimulation with 10 nM CXCL12 and addition of 2 µM Renilla Luciferase substrate coelenterazine-h (Promega). After 20 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... blots with α-PRDX6 and α-PfNAPL were incubated with respective α-mouse and α-rabbit horse radish peroxidase (HRP)-coupled secondary antibodies (1:5000, Promega) for 1h at RT ...
-
bioRxiv - Microbiology 2021Quote: ... Host cell apoptosis was measured in rabbit lung sections using the DeadEnd Colorimetric TUNEL System following the manufacturer’s instructions (Promega Corporation, Madison, WI, USA). Apoptotic and non-apoptotic cells were counted manually using the EVOS FL microscope (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... The wild-type and mutated GCE variants were expressed in vitro using the TnT Quick T7 Coupled translation rabbit reticulocyte lysate system (Promega, Madison, WI, USA). The reaction products were examined in the dextran-coated charcoal binding assay4,9 with own synthesized [3H]JH III (25.7 Ci/mmol).62 The reticulocyte lysate without DNA input was the background control.
-
bioRxiv - Plant Biology 2019Quote: ... An aliquot containing 4 μg RNA was treated for 45 min with 2 μl of DNase RQ1 (1 μg/μl) at 37 °C (Promega, UK), and purified using an RNAeasy spin column (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... Culture media was then replaced with 50 µL of qNSC/aNSC media containing 1 mM 2DG (2-deoxy-D-Glucose, provided in Glucose Uptake-Glo kit from Promega (J1342)) reagent for 10 minutes in incubator (humidified ...
-
bioRxiv - Cell Biology 2019Quote: ... cat # 129-02541) overnight at 37°C and then diluted 1/2 and digested with 0.9 µg of trypsin (Promega, cat # V5113) for eight hours at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113).
-
bioRxiv - Microbiology 2019Quote: ... gel pieces were dried in a vacuum concentrator and re-swollen with 2 ng/μl trypsin solution (sequencing grade trypsin, Promega, USA) followed by overnight digestion at 37 °C ...
-
bioRxiv - Physiology 2020Quote: ... and single-stranded cDNA was synthesized from each sample (2 μg) with M-MLV reverse transcriptase (#0000113467, Promega Corporation, Fitchburg, WI) and RNase inhibitor (40 U ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cell viability was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) dye reduction assay as described previously [20] or by CellTiterGlo assay (Promega, Walldorf, Germany) following the manufacturer’s instructions after 120h incubation.
-
bioRxiv - Immunology 2021Quote: ... Products were isolated from a 2% agarose gel using the Wizard1 SV Gel and PCR Clean-Up System (Promega, Mannheim, Germany). DNA concentration was determined via the Qubit1 1.0 Fluorometer (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113). After digestion ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... The RSB/RNasin buffer (2 ml) was prepared fresh and contained 200 ul of 10 X RSB and 50 ul RNasin (N2511, Promega, USA). The PEB buffer (10 ml ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR (qPCR) reactions were conducted in a 10-µL total volume using a 2× GoTaq® qPCR Master Mix (Promega) and run on an ABI 7500 qPCR thermocycler (Applied Biosystems) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... on-bead digestions were done with 2 µg LysC (Wako chemicals 125-05061) in 4 M urea and 4 µg trypsin (Promega ADV5113) in 1.2 M urea sequentially before quenching with 1% formic acid ...