Labshake search
Citations for Promega :
1751 - 1800 of 4685 citations for 6 Isoquinolinol 1 2 3 4 tetrahydro 1 4 methylphenyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Caspase-Glo 3/7 Assay (Promega, Cat# G8090) reagent was added to the cells and incubated for 30 min ...
-
bioRxiv - Bioengineering 2022Quote: ... by Caspase-Glo® 3/7 Assay (Promega) using GloMax Discover Microplate Reader (Promega).
-
bioRxiv - Neuroscience 2019Quote: ... organoids were embedded in 3% agarose (Promega, #V3125), sectioned at 120-µm thickness and collected in 30% sucrose in 1× PBS for cryopreservation ...
-
bioRxiv - Biochemistry 2021Quote: ... 1.8 nM 3 kb supercoiled pGEMT plasmid (Promega), and 20 nM MMTV intasomes in a final volume of 15 µL ...
-
bioRxiv - Cancer Biology 2022Quote: ... or Caspase-Glo® 3/7 (Promega, USA) respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... Caspase-Glo 3/7 3D Assay (Promega, #G8981) was added and the mixture incubated per manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... The caspase 3/7 (Caspase-GloTM Promega G8090) level was measured per the manufacturer’s instructions.
-
bioRxiv - Zoology 2023Quote: ... and 3% 20 mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact ...
-
bioRxiv - Cell Biology 2023Quote: Caspase-Glo 3/7 Assay (Promega, Fitchburg, WI) and ROS-Glo H2O2 Assay (Promega ...
-
bioRxiv - Systems Biology 2020Quote: ... TFE was then diluted to 25% with 50mM ABC, LysC (Wako Chemicals, 1:100 lysC:protein ratio) and sequencing-grade modified trypsin (Promega, 1:50 trypsin:protein ratio) was added and incubated overnight at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... TFE was then diluted to 25% with 50 mM ABC, LysC (Wako Chemicals, 1:100 lysC:protein ratio) and sequencing-grade modified trypsin (Promega, 1:50 trypsin:protein ratio) was added and incubated overnight at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were then diluted to a final guanidine chloride concentration of 1 M with 100 mM ammonium bicarbonate and digested with sequencing grade porcine trypsin (Promega, 1:100 trypsin:protein) for 22 h at 37° C ...
-
bioRxiv - Molecular Biology 2023Quote: ... or stimulated for 10 minutes or 1 hour by BRET through activation of NanoLuc’s bioluminescence with its substrate furimazine (1:100 dilution of Promega nano-Glo Live Assay). After treatment ...
-
bioRxiv - Cell Biology 2023Quote: ... a master mix was prepared by diluting the Extracellular NanoLuc Inhibitor at a 1:1000 ratio and the NanoBRET Nano-Glo Substrate at a 1:333 ratio in PBS (Promega, Madison, WI, USA). Aliquots of the Nluc substrate/inhibitor master mix (100 µl ...
-
bioRxiv - Immunology 2023Quote: ... prepared by combining ONE-Glo™ EX Luciferase Assay Buffer with ONE-Glo™ EX Luciferase Assay Substrate in 1:1 ratio (Promega, USA). After measuring the signal of the Firefly luciferase in the GloMax® 20/20 Luminometer (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μg of pPAX packaging vector and 1 μg of VSV-G envelope vector using FuGENE® HD Transfection Reagent (Promega, cat.no. E2311), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and digested with Lys-C (1/200 weight of protein; Fujifilm Wako) and sequencing grade modified trypsin (1/100 weight of protein; Promega, Madison, WI, USA) at 37 °C overnight in 0.1 % Rapigest ...
-
bioRxiv - Cancer Biology 2021Quote: ... The endpoints of the second screen were caspase 3/7 activity measured using the CaspaseGlo® 3/7 assay reagent (Promega) at the 8-hour and 16-hour time intervals ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Cancer Biology 2022Quote: PsiCHECK-2 vector (Promega) was employed to generate luciferase-based reporters for miRNA-target validation ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 µL RNasin (Promega), 250 µL TENT buffer (0.02 M Tris-HCl ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM EDTA (Promega), and 0.5% (v/v ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 mM MgCl2 (Promega), 0.5 µM of each H and L primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Trypsin (2 µg; Promega) was added to the samples before incubation at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... phospho-Erk1/2 (Promega), FAK (C-20 ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by a second dilution step to ~1 M urea with 50 mM NH4HCO3 and addition of trypsin (Promega, 1:50, 37 °C, overnight). After overnight incubation ...
-
bioRxiv - Immunology 2022Quote: ... and digested over-night with Lys-C-Trypsin mix (1:100 enzyme to protein ratio) and trypsin (Promega; 1:50 enzyme to protein ratio). Following the digestion step ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA and siRNA transfections were performed using FuGENE 6 Transfection Reagent (Promega) and Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were transfected with either Cmas or Slc35a1 DNA using FuGene 6 (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... They were then transfected with pEYFP-XRCC1 (1µg) and 6µl Fugene 6 (Promega) in Optimem (Gibco ...
-
bioRxiv - Cancer Biology 2021Quote: ... FuGENE 6 transfection reagent and CellTiter-Glo assay system were obtained from Promega. SMARTpool siGENOME siRNA targeting NTC ...
-
bioRxiv - Biophysics 2020Quote: ... epsin 1WT-EGFP or epsin 1R114A-EGFP using Fugene 6 transfection reagent (Promega). For the fluorescent uptake assays ...
-
bioRxiv - Cell Biology 2021Quote: ... 1.5 μg total DNA was combined with 4.5 μL FuGENE 6 (Promega E2691) pre-complexed in 100 μL serum-free DMEM ...
-
bioRxiv - Genetics 2022Quote: ... HEK cells were transfected with 500 ng of plasmid using FuGENE 6 (Promega) following manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: ... and target (400 ng) plasmids using 6 μL FuGene HD (Promega, Cat# E2311). 72 hrs later ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.8 μg targeting vector AAVS1-CAGGS-tdTomato using Fugene 6 transfection reagent (Promega). GFP and tdTomato double positive cells were sorted 3 days post transfection on a FACSAria (BD Biosciences) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Trypsin digestion was performed at a concentration of 6 ng/μl (Promega, #V511A). Post-digestion ...
-
bioRxiv - Molecular Biology 2024Quote: ... 25,000 HEK293-T cells were seeded and transfected with FuGENE 6 (#E231A, Promega) and plasmid DNA at the carrier (µL):DNA (µg ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Retrovirus was produced through transfection of HEK293 cells using FuGENE 6 (Promega, E2692). Two days after transfection ...