Labshake search
Citations for Promega :
1751 - 1800 of 4181 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... membrane was incubated with anti-HaloTag antibody (1:1000; Promega Corporation; G9281) and then with anti-Rabbit IgG Horseradish Peroxidase linked whole antibody (1:5000 ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 7.4) with nanoluciferase substrate Nano-Glo (Promega, final dilution 1:200). Luminescence signals at 460 ± 80 and 535 ± 35 nm were measured at 28 °C every 0.96 s in a BMG Labtech POLARStar Omega plate reader ...
-
bioRxiv - Cell Biology 2023Quote: Lysates for luciferase assay were prepared in 1× passive lysis buffer (Promega), 100 μl per well of a 24-well plate ...
-
bioRxiv - Genomics 2023Quote: ... Histones were then digested with 1 µg of sequencing grade trypsin (Promega) diluted in 50 mM ammonium bicarbonate (1:20 ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... supplemented with 1 mM CaCl2 and digested with 2 μg trypsin (Promega) for 15 h at 37ᵒC ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were further digested overnight with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR reactions using the GoTaq 1-Step RT-qPCR kit (Promega) were set-up to 10 µl final reaction volumes according to the manufacturer’s instructions containing 250 nM of each receptors primer pairs and 10 ng of RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Histones were then digested with 1 µg of sequencing grade trypsin (Promega) diluted in 50mM ammonium bicarbonate (1:20 ...
-
bioRxiv - Neuroscience 2024Quote: ... Reverse transcription was performed with 1 μg RNA using reverse transcriptase (Promega) and random hexamers for cDNA synthesis ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 mM DTT) optimized for TEV protease cleavage (ProTEV Plus, Promega, V6101). Samples were adjusted to a final volume of 10 mL with 100U TEV protease and incubated at 4°C for overnight ...
-
bioRxiv - Pathology 2024Quote: ... horseradish peroxidase-conjugated anti-rabbit IgG (1:5000, W4011; Promega, Tokyo, Japan) was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... secondary antibodies: anti-rabbit HRP or anti-mouse HRP (Promega, 1:10000).
-
bioRxiv - Developmental Biology 2024Quote: ... and 1:10000 of the HRP-conjugated Anti-Rabbit IgG (Promega W401B) and Anti-Mouse IgG (Promega W402B) ...
-
bioRxiv - Neuroscience 2024Quote: ... The HaloTag-fused proteins were subsequently labeled with 1 µM TMR (Promega) in medium for 15 min at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Histones were then digested with 1 µg of sequencing grade trypsin (Promega) diluted in 50mM ammonium bicarbonate (1:20 ...
-
bioRxiv - Microbiology 2024Quote: ... incubated with a 1:8000 dilution of anti-rabbit HRP (Promega W4011) for 1 hr ...
-
bioRxiv - Biochemistry 2024Quote: ... proteins were digested with 1 µg premixed trypsin/endoproteinase Lys-C (Promega) at 37 °C for 16 h with shaking at 800 rpm ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg trypsin/Lys-C Mix (CAT# V5072; Promega, Madison, WI, USA) was gently mixed with the sample for 14 h at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 mM CaCl2 and sequencing-grade modified porcine trypsin (Promega, Madison, WI) was added to all protein samples at a 1:50 (w/w ...
-
bioRxiv - Developmental Biology 2024Quote: ... PVDF membranes were subsequently incubated with Streptavidin Alkaline Phosphatase (1:5000; Promega) to visualize proteins in Transcend Chemiluminescence Substrate (Promega) ...
-
bioRxiv - Cell Biology 2024Quote: ... or anti-rabbit IgG HRP Conjugate (1:10000, Promega, Cat no. W4011) in blocking buffer and developed using the SuperSignal West Femto Maximum Sensitivity Substrate kit (Thermofisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 U/μL RNasin Plus RNase inhibitor (Promega, Madison, WI, USA) for 1 h at 30°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% of an equal molar mix of unmethylated lambda DNA (Promega, D1521) and fully methylated T7 was spiked into genomic DNA ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were digested overnight with 1:100 sequencing grade trypsin (V5113; Promega), followed by quantification of the generated peptide pools using a Nanodrop (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... Digestion was stopped by adding 1 µl of RNasIn Plus (Promega #N2611) and chilling on ice for 5 mins.
-
bioRxiv - Biochemistry 2024Quote: ... Histones were then digested with 1 µg of sequencing grade trypsin (Promega) (1:20 ...
-
bioRxiv - Biochemistry 2024Quote: ... 8 μL of 1/10 diluted Nano-Glo® substrate (Promega N1130) and either 10 μM effector and 200 μM partner or just 200 μM partner was added to these wells using a multichannel pipette ...
-
bioRxiv - Genetics 2024Quote: ... and 1 mM DTT in 1x Reaction Buffer A (K03-09, Promega) to a total volume of 25 μl for 1 hour at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μL of CellTiter-Glo® (Promega cat#: G7570) were added to each well and incubated for 15 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Slides were then incubated with 100 nM insert/backbone oligonucleotides in PBS ...
-
bioRxiv - Immunology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Samples were washed and endogenous biotin was blocked using Avidin/Biotin blocking kit (Vector laboratories ...
-
bioRxiv - Immunology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Slides were then incubated with 100 nM insert/backbone oligonucleotides in PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... We identified a common tracer probe (K-4, Promega), suitable for all mutants ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 4 µL FuGene HD (Promega), 1 µg sgRNA-Cas9 plasmid DNA ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 4 µL of ONE-Glo™ Luciferase reagent (Promega) was added to each well using the BioRAPTR FRD™ ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 4 µL of ONE-Glo™ Luciferase reagent (Promega) was added to each well using the BioRAPTR FRD™ ...
-
bioRxiv - Biophysics 2022Quote: ... 4% glycerol with 12 units RNasin (Promega, Madison, WI), 10 μg/ml BSA ...
-
bioRxiv - Molecular Biology 2020Quote: ... of selected 3’UTRs into the pmirGLO vector (Promega, Southampton, UK) was used to generate 3’UTR luciferase reporters essentially as previously described (9) ...
-
bioRxiv - Biochemistry 2020Quote: ... Each well was transfected with 3 uL FuGENE 6 reagent (Promega) and 130 ng pcDNA3-mouseSTING in line with manufacturer’s protocols.
-
bioRxiv - Microbiology 2021Quote: ... 3 μg of total RNA was treated with RQ1 DNase (Promega), and then purified by phenol chloroform extraction and ethanol precipitation ...
-
bioRxiv - Cancer Biology 2020Quote: ... Apoptosis was determined using Caspase 3/7-Glo assay kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... or 250 ng DNA (Nup54-mEGFP) and 3 µL FuGENE6 (Promega) in Opti-Mem I (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... and a Victor 3 or GloMax Navigator luminometer (Perkin Elmer/Promega). The 50% and 80% inhibitory concentrations (IC50 and IC80 ...
-
bioRxiv - Immunology 2023Quote: ... (3) We used the ProNex Size-Selection DNA Purification System (Promega) to purify PCR products ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples from liquid culture were placed on 3% agarose pads (Promega) containing M9 minimal media and sandwiched between glass coverslips to immobilize the cells for imaging ...
-
bioRxiv - Cancer Biology 2023Quote: ... 100 µl/well of room temperature Caspase Glo 3/7 (Promega) reagent was added to the treated and control cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used Caspase-Glo 3/7 and 8 assay systems (Promega). Approximately 2.0 × 103 cells/well were seeded in a 96-well plate and (1 ...
-
bioRxiv - Cancer Biology 2024Quote: Caspase activity was measured using Caspase-Glo® 3/7 (Promega) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2024Quote: Apoptosis was measured using the Caspase-Glo 3/7 Assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...