Labshake search
Citations for Promega :
1701 - 1750 of 3879 citations for 6 Bromo 2 trifluoromethylimidazo 1 2 a pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... molar equivalents of the appropriate TF constructs were transfected into cells alongside a 1:1 molar ratio of Luciferase (pGL4.23) to Renilla (pGL4.75, Promega) vectors ...
-
bioRxiv - Molecular Biology 2024Quote: ... an extra 1-hour room temperature incubation in 1:2500 anti-Mouse IgG-HRP secondary antibody (Promega, W4021) + 1% BSA + TBS was performed prior to Clarity Western ECL detection.
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of random hexamer primers (Promega) and 1 μg of RNA in 16.125 μl ...
-
bioRxiv - Cell Biology 2020Quote: ... Digested 1:50 v/v Trypsin (Promega) at 37°C o/n ...
-
bioRxiv - Genetics 2021Quote: ... and α-βgal (1:100, Promega, Z3781). HRP-conjugated secondary antibodies in conjunction with the TSA system (Molecular Probes ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-Halotag (Promega, G9281, 1:500), rabbit anti-Sox2 (Abcam ...
-
bioRxiv - Genomics 2021Quote: 1% of lambda phage gDNA (D1221, Promega) was spiked-into 300ng gDNA to use as an unmethylated internal control ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 unit/µl RNasin Plus (Promega, N2615), 10 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL GoScript reverse transcriptase (A5003; Promega), and 7 μL RNase-free double-distilled H2O (N2511 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-β-galactosidase (Promega, 1:2000); mouse anti-γ-tubulin (Sigma ...
-
bioRxiv - Developmental Biology 2019Quote: ... Rabbit monoclonal anti-pJNK (1:100; Promega) or rat anti-Dilp8 (1:50 ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit anti-β-Galactosidase (1:1500; Promega), mouse anti-β-Galactosidase (40-1a ...
-
bioRxiv - Microbiology 2020Quote: ... 1:1000 TuJ1 (monoclonal mouse, G712A, Promega); 1:250 NeuN (polyclonal chicken ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1% NLuc substrate (Nano-Glo, Promega) in the presence of release factors (4 nM eRF1 alone or with 4 nM eRF3a ...
-
bioRxiv - Molecular Biology 2021Quote: ... trypsin-digested (1:75 w/w, Promega) and desalted (HLB μElution plate ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 µg of sequencing grade Trypsin (Promega) was added ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 µg of sequencing grade Trypsin (Promega) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mg sequencing grade trypsin (Promega) per 200 mg total protein was added and incubated for 15 hours at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... and α-βgal (1:100, Promega, Z3781). Embryo antibody staining was performed as described [24] ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 unit of RNase ONE™ (Promega) or 0.01 unit of RNase V1 (Thermo Fischer Scientific ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 µL of GreenLys solution (FluoroTect, Promega) was supplemented to a PUREfrex2.0 mix (total volume 10 µL ...
-
bioRxiv - Microbiology 2021Quote: ... 1% SDS) containing protease inhibitor cocktail (Promega), Sodium fluoride (10 mM ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 μL of 0.2 M DTT (Promega) was added ...
-
bioRxiv - Microbiology 2020Quote: ... GoTaq 1-Step RT-qPCR kit (Promega) was used at a final volume of 20 μl with ...
-
bioRxiv - Biophysics 2020Quote: ... and 1 U/µL RNasin Plus (Promega) and flash frozen in liquid nitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... or 10:1 (w/w) elastase (Promega), using the manufacturer’s recommended temperatures for 18 hours with 600 rpm shaking ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μg sequencing grade trypsin (Promega) was added for further protein digestion (37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μL of dNTPs (20mM, Promega®), 5 μL of buffer (5x ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μL of dNTPs (20mM, Promega®), 5 μL of buffer (5x ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μg of sequencing grade trypsin (Promega), diluted in 50 mM ammonium bicarbonate ...
-
bioRxiv - Biochemistry 2021Quote: ... and 1 U/µL RNAsin Plus (Promega) and flash frozen in liquid nitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 1 U/ml RNAsin-Plus (Promega) in PBS for one minute ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1:200 RNaseIN plus RNAse inhibitor(Promega), protease inhibitor diluted into RNAse free PBS(Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of 10 mM dNTPs (Promega), 5 μl MgCl2 (GoTaq) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 U GoTaq® DNA Polymerase (Promega) and 6 µL of the template DNA ...
-
bioRxiv - Zoology 2021Quote: ... 1 U Go-Taq Flexi polymerase (Promega).
-
bioRxiv - Cell Biology 2022Quote: ... and 1:1000 RNaisin Plus (Promega, #N2615). Samples were vortexed and kept on ice ~30 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... Then 1 μg sequencing grade trypsin (Promega) was added to each sample and incubated at 37 °C overnight ...
-
bioRxiv - Developmental Biology 2022Quote: ... Corning)/RNase-free DNase (1:500, M6101,Promega) solution for 20 min at 37°C (Frank et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 1 ul of dNTP (Promega U1511). The remaining volume was brought up to 11.8 ul using nuclease-free water (ThermoFisher AM9937) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 µg of sequencing grade trypsin (Promega) diluted in 50 mM ammonium bicarbonate was added to the S-trap filter ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The BenchTop 1-kb DNA Ladder (Promega) was used to estimate the size of DNA.
-
bioRxiv - Developmental Biology 2019Quote: ... anti b-galactosidase (1:100, Promega Z3781), antiGFP (1:100 ...
-
bioRxiv - Neuroscience 2019Quote: ... and anti-mouse (1:3000; Promega #W4021) were used for detection with chemiluminescence (HyGLO Chemiluminescent HRP Antibody Detection Reagent ...
-
bioRxiv - Pathology 2020Quote: ... using GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Biochemistry 2020Quote: ... or 5:1 (w/w) Elastase (Promega), using manufacturer recommended temperatures for 18 h with 600 rpm shaking ...
-
bioRxiv - Microbiology 2020Quote: ... and 1 µM of random hexamers (Promega) in accordance with manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... containing 1 mM ethylenediaminetetraacetic acid (EDTA, Promega). The culture was then induced with 2 mM ZnCl2 and a 1 mL-sample was collected at 5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 1:1000 RNaisin Plus (Promega #N2615) before use] ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-β-gal (Promega 1:500), chicken-anti-GFP (Invitrogen 1:1000) ...