Labshake search
Citations for Promega :
1701 - 1750 of 4600 citations for 1 2 Chloropyridin 3 yl 3 3 dimethylazetidin 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR (qPCR) reactions were conducted in a 10-µL total volume using a 2× GoTaq® qPCR Master Mix (Promega) and run on an ABI 7500 qPCR thermocycler (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... on-bead digestions were done with 2 µg LysC (Wako chemicals 125-05061) in 4 M urea and 4 µg trypsin (Promega ADV5113) in 1.2 M urea sequentially before quenching with 1% formic acid ...
-
bioRxiv - Neuroscience 2022Quote: ... astrocytes were collected and processed after a 2-hour incubation period to determine intracellular glutamate levels using the Glutamate-Glo™ Assay (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Peptide digestion was initiated by adding 25 μl of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 μg trypsin (Sequencing Grade Modified Trypsin, Promega #V5117) directly on top of the column and incubating overnight at 37 °C in a drying oven ...
-
bioRxiv - Cell Biology 2021Quote: ... The primary MEFs were immortalised by transfection of 2 μg of simian virus 40 large T-antigen-expressing vector employing Fugene 6 Transfection Reagent (Promega, E2311) followed by five rounds of a 1 in10 split to achieve 1/100,000-fold splitting ...
-
bioRxiv - Molecular Biology 2020Quote: ... cell pellets were lysed in polysome lysis buffer (gradient buffer containing 100 mM KCl, 10 mM MgCl2, 0.1% NP-40, 2 mM DTT, and 40 U/ml RNasin; Promega, Leiden, Netherlands), and onto 17–50% sucrose gradients and ultracentrifuged for 2 h at 40,000 rpm ...
-
bioRxiv - Systems Biology 2020Quote: ... we cloned synthetic fragments of HERV DNA (sequences in Table S8) using gBlocks® (Integrated DNA Technologies) into psiCHECK-2 (Promega). The fragments were inserted downstream of the Renilla luciferase gene using XhoI and NotI restriction sites and DNA ligation ...
-
bioRxiv - Genomics 2021Quote: ... 23.5 μl PCR master mix (20 μl Buffer 5X, 2 μl dNTPs 10 μM, 1.5 μl GoTaq; Promega, cat. no. M3001), and 5 μl of Forward universal primer ...
-
The human sperm basal body is a complex centrosome important for embryo pre-implantation developmentbioRxiv - Developmental Biology 2021Quote: ... The resulting protein extract was first diluted to 2M urea for overnight digestion with LysC (Wako, USA) at 37°C and then diluted 2-fold for 8 h digestion with trypsin (Promega, USA) at 37°C.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... HEK293T cells were transiently transfected using Lipofectamine 2000 with 50 ng each of GLP-1R-SmBit and LgBit-β-arrestin-2 (Promega) diluted in pcDNA3.1 ...
-
bioRxiv - Microbiology 2022Quote: Various KSHV mRNA 5’-UTRs containing uORFs were cloned up stream of the Renilla luciferase gene in a psiCHECK™-2 vector (Promega) using a Gibson Assembly® Cloning Kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... 2 × 106 cells of each strain were mixed completely with equal volumes of the BacTiter-Glo reagent (Promega Corporation, Madison, WI), followed by incubation at room temperature for 15 min in the dark ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were incubated at 30 °C and luminescence was quantified after 2 h and 4 h post infection (20 μl sample plus 20 μl substrate, Nano-Glo® Luciferase Assay System, Promega). The sample was carefully removed from the upper part of the tube without disturbing the sedimented erythrocytes in the blood samples.
-
bioRxiv - Neuroscience 2024Quote: ... Peptide digestion was initiated by adding 25 µL of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 µg trypsin (Sequencing Grade Modified Trypsin, Promega, # V5117) directly on top of the column and incubating overnight at 37 °C ...
-
bioRxiv - Immunology 2024Quote: ... Quantification of SARS-CoV-2 RVP infection was determined using the Renilla-Glo® luciferase assay system (Promega Corp., Madison, WI). Microtiter assay plates were centrifuged for 5 min at 2000 rpm to prevent cell loss ...
-
bioRxiv - Immunology 2023Quote: ... reverse primer – GCTTCATCTCAACCTCCGTC) using genomic DNA from monocytes and ligated in dual luciferase reporter vector psiCHECK-2 downstream of Renilla luciferase (Promega Corporation) vector in Xho1 and Not1 sites in MCS ...
-
bioRxiv - Biophysics 2023Quote: ... transfection was carried out by adding 2 μg of freshly prepared bacmid DNA and 6 μL of FuGene HD transfection reagent (Promega, E2311), following the instructions provided by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μL of furimazine substrate was added to the reaction well from a working reagent stock of a 2:100 NanoDLR Stop & Glo Substrate to Buffer ratio (Promega #N1610). A total well volume of approximately 112.5 μL was incubated at room temperature for 2 minutes prior to measuring luminescence and OD600 readings on an EnVision plate reader (PerkinElmer).
-
bioRxiv - Cell Biology 2023Quote: ... the 200k pellets were digested for 2 h at 37°C with 0.4 µg of Trypsin/Lys-C (Promega CAT#: V5071) and then overnight by adding 0.4 µg of Trypsin/Lys-C ...
-
bioRxiv - Genetics 2023Quote: ... After adding 2 µg MS grade trypsin in the intraspecific hybrids (Pierce Biotechnology, Waltham, MA) and polyploids (Promega Corporation, Madison, WI) to each sample ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 µg of bacmid DNA were used to transfect Sf21 cells for baculovirus generation using FuGENE® transfection reagent (Promega). The protein was expressed in Lonza Insect-EXPRESS™ medium for 72-96 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Levels of reporter mRNAs in eggs were measured 6 hrs post-injection by RT-qPCR using the GoTaq 2-Step RT-qPCR system as per manufacturer’s instructions (Promega, Madison, WI) with random primers for reverse transcription and oligos listed in Table 1 for the qPCR step.
-
bioRxiv - Neuroscience 2023Quote: ... equal amount of RNA (2 μg) from each sample was subjected to cDNA synthesis using reverse transcriptase Kit (Promega Corporation, USA) following standard procedures ...
-
bioRxiv - Microbiology 2023Quote: ... for 2 hours at 72 hours and lysed at 98 hours using 25 μl Dual-Glo® Luciferase Assay System (Promega). Luminescence was measured ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 2 µl of the lysed samples were added to 25 µl PCR reactions with GoTaq Green mastermix (Promega, Cat. No. M7123). After amplification ...
-
bioRxiv - Microbiology 2024Quote: ... Contaminating DNA in the samples were removed through incubation at 37°C for 2 h using RNase-free DNase I (Promega, USA). All RNAs in the samples were converted into cDNA using a cDNA EcoDry Premix (Clontech ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of RNA was used astemplate to generate cDNAs using the ImProm-II Reverse Transcription system (Promega, Madison, Wisconsin, USA). qPCR reactions were carried out on an MX3000P system (AgilentTechnologies ...
-
bioRxiv - Plant Biology 2024Quote: ... The FLAG-tagged VRS5 and GFP were expressed in-vitro using 2 µg plasmid and TnT® SP6 High-Yield Wheat Germ Protein Expression System (Promega). Expressed FLAG-tagged proteins were bound with prepared DNA libraries for 2 hours at RT followed by immobilization by anti-FLAG magnetic beads (SIGMA) ...
-
bioRxiv - Immunology 2024Quote: SARS-CoV-2 variant spike pseudotyped lentiviral particles were produced in 293T cells (ATCC) using Fugene transfection reagent 6 (Promega; E2691). Two million cells were seeded in D10 (DMEM(Life Technologies ...
-
bioRxiv - Immunology 2024Quote: ... nLuc signal was quantified within 2 hr following 50 µL intraperitoneal injection of reconstituted Nano-Glo in Vivo FFz substrate (Promega, CS320501) as photons per sec (p/s ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 48 hours (Figure 2) of drug exposure at 37°C/5% CO2 and assayed for cell viability using CellTiter-Glo® (Promega) by following manufacturer instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-PCR was executed in a total of 20μl reaction volume which includes 2 X Mix SYBR green I (10μl; Promega Corporation, Madison, WI, USA), primer (0.25μl ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of pCS2-HA-NFATc3 was incubated for 2 h at 30°C in 50 μl of the TNT® SP6 coupled wheat germ extract system (Promega, #L5030), according to the instructions of the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... protein ratio of 1:50 w/w for 2 hours at 37°C and further digested with 30 µL 50 mM TEAB containing trypsin (Sequencing Grade Modified, Promega, Madison, WI) at a trypsin ...
-
bioRxiv - Plant Biology 2021Quote: ... The PCR product was run on 2% agarose gel and the expected bands were eluted using Wizard® SV Gel and PCR cleanup kit (Promega, USA),cloned in pGEM-T easy vector (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... The light production was then monitored at 20-minute intervals at 37 °C for 2 hours using the Glomax 20/20 Luminometer (Promega, Madison, WI). A final measurement was also taken after the samples had been allowed to incubate overnight at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Filters were transferred to 2 mL microfuge tubes for further processing using the Maxwell® RSC PureFood GMO and Authentication Kit (Promega Corporation) with a modified version of the kit protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... (49) as a negative control (2 μg of DNA per well of 6 well plate) with FuGene transfection reagent (Promega, Madison, WI) according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: ... for gram-negative bacteria and cDNA library preparation was performed using the GoTaq® 2-Step RT-qPCR System (A6010, Promega, USA). The RT-PCR was done using the Applied Biosystems™ 7500 Real-Time PCR System and primers shown in the supplementary data table S2 (35-38) ...
-
bioRxiv - Pathology 2020Quote: ... RNA (2 µg) was reverse transcribed through the GoScript™ Reverse Transcription System performed with Oligo(dT)15 (Promega, Madison, Wisconsin, EUA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... OXA-111-NcoI F or OXA-71-NcoI F and OXA-66-XhoI R primers (Table 2) and TA cloned into the vector pGEM-T Easy (Promega, United Kingdom). The inserts were confirmed by sequencing with the universal T7 Promoter primer ...
-
bioRxiv - Immunology 2021Quote: ... Luminescence was read after 2 minutes shaking on an orbital shaker and 10 min incubation at RT using the GloMax instrument (Promega, Madison, USA).
-
bioRxiv - Immunology 2021Quote: The effect of neutralization capacity of Multivalent DARPin was evaluated by exposing serial dilutions of the DARPin candidates to increasing titers of SARS-CoV-2 and determining cell protection by CellTiter-Glo assay (Promega, Madison, USA). Serial dilution of DARPin candidates were prepared in 96 well plates in 100 µl cell culture medium (2%-FBS-MEM + HSA ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized via reverse-transcription of 2-5 μg of RNA using M-MLV Reverse Transcriptase (200 U, Promega, Wisconsin, USA), random primers (10 ng/μl ...
-
bioRxiv - Biophysics 2020Quote: ... First-strand cDNA was synthesized from 2 μg of total RNA with oligo (dT)15 primers and GoScript™ Reverse Transcriptase (Promega, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were extracted from a 2% agarose gel and purified using AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, USA) and quantified by QuantiFluor™-ST (Promega, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were incubated for an additional 2 – 6 days and cell growth was quantified using CellTiter-Glo® 2.0 Reagent (Promega, Cat. #924C). For immunoblot analysis ...
-
bioRxiv - Biophysics 2022Quote: pHalo-PPARγ2 expresses human PPARγ isoform 2 fused to HaloTag in the N-terminus under a CMVd1 promoter (Promega ORF clone #FHC08305). PPARγ2 mutants were generated by nucleotide substitution using the QuikChange II XL Site Directed Mutagenesis Kit (Stratagene ...