Labshake search
Citations for Promega :
1651 - 1700 of 2737 citations for TREM 1 Human HEK 293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 1 µL cDNA was used as template for 25 cycles of PCR using GoTaq polymerase (Promega) targeting the TMV replicase using forward primer 5’ CCGCGAATCTTATGTGGAAT 3’ and reverse primer 5’ TCCTCCAAGTGTTCCCAATC 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... A 1:10 solution of sample homogenate to colentrazine was analyzed on a GloMax Explorer (Promega).
-
bioRxiv - Neuroscience 2022Quote: ... using 0.5 - 1 μg of cDNA and FuGene as per the manufacturer’s instructions (Promega, Madison, WI). Cells were fixed for immunocytochemistry 24 or 48 h after transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1.33 μL 1 M Tris-HCL pH 8.5 and 7.8 μL 0.5 mg/mL trypsin (Promega) were added and proteins left to digest for 16 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were diluted with 875uL of 50mM Tris buffer along with Trypsin (1:100, Promega #V511C) for overnight digestion ...
-
bioRxiv - Molecular Biology 2021Quote: Primary antibodies and the dilutions used are as follows: anti-Halo (mouse, Promega G9211, 1:200); anti-Ezh2 (mouse ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 0 or 1 μg Sequencing Grade Modified Trypsin (0 or 10 μl; #V5111, Promega, WI, USA) that was reconstituted within trypsin re-suspension buffer (50 mM acetic acid ...
-
bioRxiv - Biochemistry 2019Quote: ... the sample was digested overnight at 37 °C with trypsin (1:200 w:w; Promega, Madison, WI). Peptides were desalted using a Sep-Pak (Waters ...
-
bioRxiv - Cell Biology 2019Quote: The primary antibody was incubated in 1× PBST (PBS + 0.1% Triton X-100) + 0.2% BSA (Promega) overnight at 4°C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Total DNA was isolated from 1 ml culture using the Wizard Genomic DNA Purification Kit (Promega). Concentration and quality of the extracted DNA was assessed using the NanoDrop™ (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNAs were diluted 1:5 and qPCR was performed using GoTaq® qPCR Master Mix (Promega). Primers for mCyb5r3 were ...
-
bioRxiv - Pathology 2020Quote: ... The extracted RNA (1 μg) was reverse-transcribed using Reverse Transcription System (Promega, Madison, Wisconsin, USA), and cDNAs were amplified using GeneAmp PCR System 9700 (Applied Biosystems ...
-
bioRxiv - Physiology 2019Quote: ... Plasmid DNA (6 µg) was mixed (1 : 3 ratio) with transfection reagent (Fugene 6; Promega, UK) in reduced serum media (OptiMEM ...
-
bioRxiv - Biochemistry 2019Quote: ... 20 μg of each sample was digested by adding 1 μg of sequencing grade trypsin (Promega) for 16 h at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... from the 1% TAE agarose gel and cloned into the pGEM-T Easy Vector System (Promega) for transformation ...
-
bioRxiv - Biochemistry 2021Quote: ... the membrane was imaged using 500 µl of 1:1000 NanoGlo substrate (Promega, catalogue number: N1120) diluted in 10 mM sodium phosphate buffer pH 7.0.
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were digested by incubation with sequencing-grade modified trypsin (1/50 w/w; Promega, V5113) for 12 h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... One hundred nanograms of genomic DNA spiked with 1% (w/w) of unmethylated lambda DNA (Promega) was used for the library preparation ...
-
bioRxiv - Bioengineering 2021Quote: ... RNA (1 μg) was subjected to RT-PCR in accordance with the protocol provided by Promega. The transcripts were quantitated and normalized to the internal GAPDH control ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples were digested overnight at 37°C with 1 μg trypsin (sequencing grade; #V5111, Promega) per 100 μg of protein.
-
bioRxiv - Microbiology 2020Quote: ... The cells were then lysed with 40 μL of 1× Cell Culture Lysis Reagent (Promega, E153A) for 40 minutes with shaking at 500 rpm ...
-
bioRxiv - Molecular Biology 2020Quote: ... at a 1:1000 dilution and a secondary antibody against rabbit coupled to HRP (Promega W4011) at a 1:20 000 dilution.
-
bioRxiv - Microbiology 2020Quote: ... cells were washed once with PBS and lysed in 40μl of 1 x CCLR buffer (Promega) for 10 min on a rocking plate at RT ...
-
bioRxiv - Microbiology 2021Quote: ... The infected cells were collected and lysed with 100 μl of 1× passive lysis buffer (Promega). The samples were sonicated for 30 seconds before centrifugation and 5 μl of the supernatants were collected for luciferase expression reading by the dual-luciferase reporter assay system (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 µg of RNA was used to create cDNA with the ImpromII Reverse Transcriptase Kit (Promega) following the manufactures standard protocol including oligodT oligos and 4.8 M MgCl2 in each 20 µl reaction (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... Promega standard protocol was used to synthesise cDNA from 1 μg RNA (Promega, Madison, Wisconsin, USA). Cripto ...
-
bioRxiv - Cell Biology 2021Quote: ... USA] and enzymatically proteolysed using trypsin/LysC (1:25 enzyme:protein ratio; V5072, Promega, Madison, WI, USA). Peptides from each sample were labelled using the ten-plex TMT reagent kit (90110 ...
-
bioRxiv - Neuroscience 2020Quote: ... all cells were incubated in the following: mouse anti-βIII tubulin (1:1000; 2 hr; Promega) and goat anti-mouse Alexa 546 (1:1000 ...
-
bioRxiv - Immunology 2022Quote: ... Proteins were digested into peptides with 12μL of 1:10 Trypsin Gold (Promega, Madison, Wisconsin, V528A) in 50mM TEAB per sample ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA synthesis was prepared with 1 µg of RNA using an AMV reverse transcription system (Promega) and random primers according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were digested by incubation with sequencing-grade modified trypsin (1/50 w/w; Promega,V5113) for 12 h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μg of genomic DNA from the corresponding isolates was digested by EcoRI (Promega, Madison, WI), the amplified DNA fragments were subjected to ethanol precipitation (65) ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were then subjected to immunoblotting and probed for anti-p75NTR (Promega, Cat: G323A, 1:300) and anti-GAPDH (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... for 4 h at 800 rpm and 42°C or thermolysine (1:50) (Promega, Walldorf, Germany) for 2 h at 800 rpm and 60°C ...
-
bioRxiv - Microbiology 2020Quote: Plasmid DNA was combined at a 3:1 ratio of FuGENE® 6 Transfection Reagent (Promega) to DNA and incubated 20 min at RT ...
-
bioRxiv - Biochemistry 2021Quote: ... Reverse transcription was performed with 1 unit of Avian Myoblastosis Virus (AMV) reverse transcriptase (Promega®) at 42°C for 2 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... first-strand cDNA was synthesized using 1 µg total RNA with MMLV Reverse Transcription Kit (Promega) and poly-T primer ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 µL of PBS containing 4 μg/mL Hoechst and 1/10000 CellTox Green Dye (Promega) were were dispensed per well 1 h prior to imaging at Cytation5 image cytometer or Opera Phenix (Perkin Elmer ...
-
bioRxiv - Cell Biology 2020Quote: ... DLD-1 cells were transfected with guide plasmids and donor plasmid using ViaFect™ (#E4981, Promega) on 3.5cm dishes ...
-
bioRxiv - Cancer Biology 2019Quote: ... and trypsin digestion was performed with a 1:50 mass ratio of sequencing-grade trypsin (Promega) to total protein for 16h at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1mM DTT and RNasin Plus (1:50) and 25 units of ProTEV Plus Protease (Promega V6101) and incubated 2 hrs at 30°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... were secondary incubated with anti-mouse IgG (H+L) horseradish peroxidase coupled (1:3,000, W402b, Promega) and polyclonal anti-rabbit IgG (1:5000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies used were: rabbit and mouse anti-βGal (1/1000; Promega and MP Biomedicals, respectiveley), rat anti-Ser (1/1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... 400 ng of RNA was treated with 1 unit of RQ1 RNase-Free DNase (Promega, M610A) at 37°C for 30 minutes and was inactivated by RQ1 DNase Stop Solution at 65°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The adapter ligated aRNA was then mixed with 1 µl of dNTPs (10 mM each) (Promega) and 2 µl of RTP oligonucleotide (20 µM ...
-
bioRxiv - Molecular Biology 2019Quote: ... proteins were digested for 6 h at 37°C with 4ng.μL−1 of modified trypsin (Promega) dissolved in 50 mM NH4CO3 ...
-
bioRxiv - Neuroscience 2019Quote: ... Proteins were digested overnight at 37°C with 1 μg of mass spectrometry grade Trypsin (Promega). The resulting peptide samples were cleaned up for mass spectrometry in a Sep-Pak C18 column (Waters ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then with 1:5000 of anti-rabbit (#W401B) or anti-mouse (#W402B) secondary antibodies (Promega).
-
bioRxiv - Biochemistry 2021Quote: ... along with Renilla luciferase (50 ng of pGL4.70[hRluc] or 1 ng of pRL-null; Promega), and pCI expression vector encoding either FL-PC1 ...
-
bioRxiv - Systems Biology 2021Quote: ... Both 1° and 2° assays were performed with 2x PCR master mix (Promega Corporation, Wisconsin, USA). The final PCR product from the 2° nested PCR was checked by electrophoresis in a 1.5% agarose gel ...