Labshake search
Citations for Promega :
1651 - 1700 of 4730 citations for 6 hydroxy 4 4 7a trimethyl 6 7 dihydro 5H 1 benzofuran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... One microgram of total RNA was reverse transcribed using an oligo(dT)15 and the MMLV-RT (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: One µl of bisulfite-converted DNA was subjected to PCR using the G2 Green Mix (Promega, Mannheim – Germany) with bisulfite-specific primers at temperatures and concentrations as indicated in Appendix 3 ...
-
bioRxiv - Microbiology 2021Quote: Cellular viability was determined using non-radioactive CellTiter 96 AQueous One Solution Cell Proliferation Assay (MTS) reagent (Promega), according to the manufacturer’s recommendations29 ...
-
bioRxiv - Cancer Biology 2020Quote: ... One volume was used for extraction of chromosomal DNA using the standard Wizard genomic DNA prep kit (Promega) protocol (CRC2631) ...
-
bioRxiv - Biophysics 2021Quote: ... Cells were then lysed and luciferase activity assessed using the ONE-Glo™ EX Luciferase Assay System (Promega) according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sample concentrations were determined using the QuantiFluor ONE dsDNA System and a Quantus Fluorometer (both Promega, Southampton, UK). Equimolar amounts of each sample were pooled ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell titer 96® aqueous one solution cell proliferation (MTS) assay (catalog no. G3580) was purchased from Promega Corporation (Madison ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 30 μL supernatant was removed and mixed with 30 μL ONE-Glo™ EX Luciferase Assay Reagent (Promega) and incubated at room temperature for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... cell viability was monitored using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (Promega, Madison, WI, USA). VeroE6 cells and Huh7.5 cells were seeded in 96-well flat-bottom plates at 10,000 and 9,000 cells per well ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cell proliferation was assessed using the CellTiter96 Aqueous One Solution Cell Proliferation Assay (MTS) kit (Promega, Madison, WI).
-
bioRxiv - Pathology 2021Quote: ... One µL of PCR product was employed to produce the transcripts with the T7 RNA polymerase (Promega, USA), setting a 20 µL-reaction for 2 hours at 37 °C ...
-
bioRxiv - Biophysics 2021Quote: ... Transfection was performed one day before assaying luciferase expression with the Dual-Luciferase Reporter Assay System (Promega E1910) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Cell viability was determined using CellTiter 96® Aqueous One solution according to the manufacturer’s instructions (Promega, Singapore).
-
bioRxiv - Molecular Biology 2022Quote: ... One gel slice was excised for each purification and in-gel digested by using trypsin/LysC (Promega, V5072). Peptides extracted from each band were then loaded onto a homemade C18 StageTips for desalting ...
-
bioRxiv - Systems Biology 2023Quote: ... Samples were incubated for one hour at 47 oC with sequencing grade trypsin (Promega, San Luis Obispo, CA) dissolved in 50 mM TEAB at a 1:25 (w/w ...
-
bioRxiv - Bioengineering 2023Quote: ... CellTiter 96 AQueous One Solution Cell Proliferation Assay (MTS) and CellTiter Blue were purchased from Promega (Madison, WI). Annexin V-Orange (4759 ...
-
bioRxiv - Molecular Biology 2023Quote: ... One third of the purified volume (∼ 0.5 μg) was amplified with T7-RNA polymerase (Promega, Madison, WI, USA) integrating DIG-labeled ribonucleotides (BMB Cat ...
-
bioRxiv - Cancer Biology 2023Quote: ... 72-hour viability assays were performed using CellTiter 96® AQueous One Solution Cell Proliferation Assay (Promega, G3580) following manufacturer recommendations and 490nM absorbance measured using a CLARIOstar plate reader (BMG Labtech) ...
-
bioRxiv - Neuroscience 2023Quote: ... The pool was quantified by Fluorometry using the QuantiFluor ONE dsDNA System (Cat# E4871, Promega, Madison, WI, USA) before sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: HeLa or HEK cells were cultured for at least one day and transfected using FUGENE HD reagent (Promega) according to manufacturer’s instruction ...
-
bioRxiv - Genomics 2023Quote: ... song: 150 μg total) was quantified using the Quantus Fluorometer (QuantiFluor ONE dsDNA Dye assay; Promega, Madison, WI). The size distribution of the HMW DNA was estimated using the Femto Pulse system (Agilent ...
-
bioRxiv - Cell Biology 2024Quote: ... The pool was quantified by Fluorometry using the QuantiFluor ONE dsDNA System (Cat# E4871, Promega, Madison, WI, USA) and sequenced Single-Reads 76 bases (in addition ...
-
bioRxiv - Cell Biology 2024Quote: ... The pool was quantified by Fluorometry using the QuantiFluor ONE dsDNA System (Cat# E4871, Promega, Madison, WI, USA) and sequenced Single-Reads 76 bases (in addition ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were subjected to digestion of Lys-C (Wako Chemicals) (1:50) for 2 h at RT and then to trypsin (Promega) (1:50 ...
-
bioRxiv - Microbiology 2019Quote: Protein digestion - for samples processed with reagent 1 and 2 as well as for supernatants (proteomes) MS grade trypsin (Promega) was used at 1:1000 w/w protease:protein ...
-
bioRxiv - Biochemistry 2021Quote: Pulldowns with cellular extracts were carried out as described for GFP-immunoprecipitations using 1-2 μg of GST-fused proteins bound to glutathione magnetic beads (Promega). For immunoprecipitations of recombinant proteins ...
-
bioRxiv - Genomics 2021Quote: ... Cell number was normalized before seeding by measuring ATP levels in a 1:2 dilution series of digested organoids with CellTiter-Glo (Promega). The number of cells matching 10,000 photons (Berthold Technologies ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 hours at 37° C and subsequently diluting to 1 M urea with 50 mM NH4HCO3 and finally adding 2% (w/w) trypsin (Promega) for 14 hours at 37° C ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were resuspended at 2 x 106 cell mL-1 in complete media and HaloTag substrate conjugated to TMR (Promega) was added at a final concentration of 5 μM ...
-
bioRxiv - Microbiology 2022Quote: ... the HSV-1 ICP0 3’UTR was amplified from pICP0(HSV-1) using psiV1ICP0UTRf and psiV1ICP0UTRr primers and inserted into psiCHECK-2 (Promega). psiChHVICP03UTR was constructed by inserting the synthesized ChHV ICP0 3’ UTR into the same position ...
-
bioRxiv - Microbiology 2021Quote: ... spxB gene region containing the ORF (amplified from R6 genome using primer set 1-2) was cloned into pGEM-T Easy vector (Promega). spxB ORF was disrupted by cloning a kanamycin resistance cassette (amplified from pIBD38 ...
-
bioRxiv - Genomics 2019Quote: ... 2 μl US bait primer and 2 μl Illumina universal primer 10 μM (0,4 μM final concentration each primer) and 1 μl GoTaq (Promega, M5005) with the following program ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were washed twice with UA buffer and twice with 50mM ammonium bicarbonate prior to digest of the immobilized proteins on the filter for 2 h at RT using 1 mg Lys-C (Wako Chemicals) and for 16 h at 37C using 2 mg trypsin (Promega). Tryptic peptides were collected by centrifugation (10 min at 14,000 g) ...
-
bioRxiv - Genomics 2020Quote: ... lysyl endopeptidase (Wako) at 25°C for 2 hours and further digested overnight with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR (SARS-CoV-2 and MS2 viral genome detection) were performed with the GoTaq 1-step qRt-PCR kit (Promega) using 3.8µL of extracted RNA and 6.2µL of RT-qPCR mix that contains 250nM of each primer and 75nM of probe ...
-
bioRxiv - Cell Biology 2020Quote: ... The reduced and alkylated protein lysates were diluted using 50 mM Tris-Cl to obtain a final concentration of 2 M urea in solution followed by overnight digestion with trypsin (1:1000)(Promega). Peptides were then desalted using c-18 Sep-Pack columns (Waters) ...
-
bioRxiv - Genetics 2020Quote: ... 1-2 μL of cDNA was used for 25 μL PCR reactions using the GoTaq Hot Start Master Mix (Promega). Cycling parameters consisted of an initial denaturation of 95°C for 2 min. ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were diluted 8x in 50 mM ammonium bicarbonate to reduce the urea concentration to 1 M and protein digestion was performed overnight at 37 C by addition of 2 µg of trypsin (Promega) per sample.
-
bioRxiv - Neuroscience 2023Quote: ... samples were diluted with 50 mM NH4HCO3 to a final concentration of less than 2 M urea and were further digested overnight with 1:25 (w/w) trypsin (Promega) at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... to a final urea concentration ˂ 2 M and then digested with modified trypsin (1:50 w/w) (Sequencing Grade, Promega) at 37°C for 3 h ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCRs were performed with MLV SU or 2-LTR primers (Table 1) using a Power SYBR green PCR kit (Promega) and the QuantStudio 5 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2023Quote: ... lysyl endopeptidase (Wako) at 25°C for 2 hours followed by another overnight digestion with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Neuroscience 2023Quote: ... lysyl endopeptidase (Wako) at 25°C for 2 hours and further digested overnight with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Biochemistry 2022Quote: 2’-Deoxythymidine-5’-triphosphate (dTTP) and 2’-deoxyguanosine-5’-triphosphate (dGTP) were obtained from Promega. 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: Cell death by apoptosis was measured using Caspase-Glo 3/7 luminescent assay system kit according to the manufacturer’s instructions (Promega Madison, WI). Briefly ...
-
bioRxiv - Microbiology 2022Quote: Activity of caspases-3/7 and -8 were assessed using the corresponding Caspase-Glo® Assays in white-walled 96-well plates (Promega).
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...