Labshake search
Citations for Promega :
1601 - 1650 of 5154 citations for Rat Presenilin Enhancer 2 Homolog C. Elegans PSENEN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... cDNA was synthesized with reverse transcriptase kit (Promega) using the same amount of RNA for all the samples (settled by the sample with the lowest concentration of RNA) ...
-
bioRxiv - Cancer Biology 2023Quote: The SV total RNA isolation system kit (Promega) was employed to isolate RNA from cells ...
-
bioRxiv - Immunology 2023Quote: Using Go Script cDNA Kit (Promega, Fitchburg USA) RNA samples were processed according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... using a luciferase assay kit (#E1500 Promega, USA) as per the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Promega GoTaq qRT-PCR kit (Promega, Fitchburg USA) was used according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... the Dual-Glo luciferase assay kit from Promega is used for luciferase analysis ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The ReverTra Ace-cDNA synthesis kit (Promega, USA) was used to synthesize cDNA from 2 μg of total RNA ...
-
bioRxiv - Microbiology 2023Quote: ... the CellTox Green Cytotoxicity Assay Kit from Promega was performed using a modified version Endpoint Step Protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... 15 μl of Kinase detection reagent (Promega kit) was added to the wells ...
-
bioRxiv - Biochemistry 2023Quote: ... 7.5 μl of ADP-Glo reagent (Promega kit) was added to each reaction well and incubated at room temp for 40 min ...
-
bioRxiv - Genomics 2022Quote: ... or the Wizard Genomic DNA Purification Kit (Promega) after lysostaphin treatment ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Triglyceride-GlowTM assay kit (Promega, Madison, WI), respectively ...
-
bioRxiv - Microbiology 2023Quote: ... using the Wizard Genomic DNA purification kit (Promega). Quantitative PCR was used to measure the frequency of each distinguishable allele of the tvr locus ...
-
bioRxiv - Microbiology 2023Quote: ... we used the Kinase-Glo kit (Promega, V6728) to assess the activity of purified FruK.
-
bioRxiv - Neuroscience 2023Quote: ... mRNA was extracted using a PolyATract kit (Promega) and was reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The DNA purification kit was purchased from Promega GmbH (Walldorf ...
-
bioRxiv - Microbiology 2023Quote: ... Maxwell 16 DNA purification kits (Promega, Madison, WI) were used for DNA extraction from gut samples ...
-
bioRxiv - Immunology 2023Quote: was done using the CellTiter Glo Kit (Promega).
-
bioRxiv - Synthetic Biology 2024Quote: ... DNA yields were quantified (QuantiFluor® kit, Promega), and DNA concentrations were normalized to 2 ng/100 bp of amplicon length and submitted for Sanger sequencing with the appropriate forward PCR primer ...
-
bioRxiv - Evolutionary Biology 2024Quote: The Dual luciferase reporter assay kit (Promega, USA) was used to measure the reporter gene expression ...
-
bioRxiv - Cancer Biology 2024Quote: ... and CellTiter-Glo 2.0 assay kit (Promega; G9241), respectively ...
-
bioRxiv - Developmental Biology 2024Quote: A DeadEnd Colorimetric TUNEL assay kit (Promega - G7360) was used to detect apoptosis in Hmgcr knockdown cells ...
-
bioRxiv - Microbiology 2024Quote: ... was quantified using the Cytotox96 Assay Kit (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2024Quote: ... utilising the Wizard Genomic DNA Purification kit (Promega A1120 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... NanoLuc luciferase activity was with the kit (Promega) measured according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: ... plates were incubated at 37°C for 72 hours prior to assessing luciferase activity using the Renilla-Glo Luciferase Assay System (Promega, Madison, WI, USA). Readout of eGFP was done by incubating and monitoring plates at 37°C for 72h in an IncuCyte® (Essen BioScience Inc. ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA was prepared from a single colony cultured overnight at 37°C in LB using the Maxwell 16 system (Promega Corp., Madison, WI). Libraries for Illumina sequencing were prepared using either Nextera XT (Illumina ...
-
bioRxiv - Plant Biology 2020Quote: ... approximately 0.6 mg IgG-enriched proteins were first digested on the beads with mass spectrometry-grade Trypsin/Lys- C Mix (Promega, Madison, WI, USA) at a 1:50 (enzyme/substrate ...
-
bioRxiv - Microbiology 2019Quote: ... Samples were then diluted 4-fold with 100 mM Tris HCl pH 8.5 to reach a concentration of 2M urea and then re-incubated overnight at 37°C with 1 µg Sequencing Grade Modified Trypsin (Promega, Madison, WI, USA). A second incubation with the same amount of trypsin (5 h at 37°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pellets were reconstituted and digested with endoproteinase Lys-C (Alpha Laboratories, UK) for 1 hour at room temperature and trypsin (Promega, Madison, WI, USA) overnight at 35°C.
-
bioRxiv - Cancer Biology 2020Quote: ... The lysate obtained from each tumour sample was mixed at 1:1 ratio with the super-SILAC standard prior to FASP digestion41 with Endoproteinase Lys-C (Alpha Laboratories, UK) and trypsin (Promega, Madison, WI, USA).
-
bioRxiv - Immunology 2022Quote: ... and the RNA was precipitated with an equivalent volume of isopropanol and incubated at 55°C for 10 minutes before being resuspended in 50 μL of RNase-free water (Promega, Madison, WI, USA). We determined the concentrations of RNA using a Smart-Spec plus spectrophotometer (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... collected by centrifugation (17,000 g for 10 min at 4°C) and solubilized in 20 μl 50 mM TEAB containing 0.2 % ProteaseMAXTM Surfactant (Promega UK Ltd, Cat. # V2071) for 1-2 h with vortex and occasional sonication ...
-
bioRxiv - Molecular Biology 2021Quote: ... The transfected cells were cultured at 37°C for 36 h and subjected to luciferase activity analysis using the Dual-Glo Luciferase Assay System (Promega, Madison, WI, USA).
-
bioRxiv - Cell Biology 2019Quote: ... containing T7 promoter at the 5’ end at 37 °C using the T7 RiboMax Express Large-Scale RNA Production System (Promega Corp., Madison, WI), following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... Tryptic samples were subsequently diluted to 2M urea in 100mM Tris/HCl pH 8 and digested over night at 37°C (Promega, enzyme:protein 1:100). Samples were adjusted to pH 2 using 10% trifluoroacetic acid (TFA ...
-
bioRxiv - Immunology 2021Quote: ... CDC was measured after incubation for 3 hours at 37 °C 5% CO2 with a luminometer using the CytoTox-Glo Cytotoxicity Assay (Promega; Cat. Nr.: G9291) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2022Quote: ... They were later subjected to reverse transcription for 45 min at 37°C with 200 U of reverse transcriptase M-MLV (Promega, Madison, WI, USA) in the appropriate buffer.
-
bioRxiv - Neuroscience 2022Quote: ... and 30 s extension at 72 °C using the specific primers (Forward: CCACGCAACACACAGTCAAG, Reverse: GCAAGTTACTTTGCAGAGGTC) and GoTaq G2 DNA polymerase (Promega, Madison, Wisconsin, USA). Each PCR mixture (15 μl ...
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro transcribed and translated FLAG-tagged ERRα protein was made using the TnT reticulocyte reaction (Promega cat #L1170, 2h on 37°C) or the TnT wheat germ extract (cat #L5030 ...
-
bioRxiv - Bioengineering 2023Quote: ... Reverse transcription was performed at 70 °C for 5 min and 42 °C for 60 min with 1 µg total RNA using ImProm-II reverse transcriptase (Promega, Madison, WI, USA) and 250 ng oligo(dT)12-18 primers (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: ... 35S-methionine-labeled Ctb or its derivatives were produced in coupled in vitro transcription and translation reaction (IVTT, at 30 °C for 1 h) using TNT Quick Coupled Transcription/Translation System (cat#L1170, Promega, Madison, WI, USA). Prey proteins were diluted in binding buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Systems Biology 2023Quote: ... at the ratio of 1:50 for 3 h at 37°C and then using trypsin (sequencing grade modified trypsin; Promega, Fitchburg, WI, USA) at the ratio of 1:50 at 37°C overnight (for 15 h to 18 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... and digested with Lys-C (1/200 weight of protein; Fujifilm Wako) and sequencing grade modified trypsin (1/100 weight of protein; Promega, Madison, WI, USA) at 37 °C overnight in 0.1 % Rapigest ...
-
bioRxiv - Plant Biology 2024Quote: ... 25 µg of phloem sap and 50 µg of leaf tissue protein extract were then digested in solution using a Trypsin/Lys-C mixture (Mass Spec Grade, Promega, Madison, WI, USA) according to the instruction manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... Seventy micrograms of protein were digested overnight using the filter-aided sample preparation (FASP) method 23 with Trypsin/Lys-C mix (Promega, Madison, WI, USA) (enzyme-to-protein ratio 1:35 ...
-
bioRxiv - Immunology 2022Quote: Lung Lin-cells of infant and adult sepsis-surviving animals were isolated and the total DNA was extracted using a commercial kit (Wizard® Genomic DNA Purification Kit, Promega) according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2020Quote: ... CellTiter 96® Aqueous One Solution cell proliferation assay kit and ApoTox-Glo™ Triplex Assay kit was obtained from Promega, Australia ...
-
bioRxiv - Biochemistry 2019Quote: ... N-glycans were released from the membrane-bound protein using 2 U PNGase F (Promega, WI, USA) with overnight incubation at 37°C ...
-
bioRxiv - Plant Biology 2019Quote: ... using 1 - 2 µg of total RNA and 250 ng of a mixture of random hexanucleotides (Promega) and incubated for 50 min at 50°C ...