Labshake search
Citations for Promega :
1601 - 1650 of 3880 citations for QuantiChrom Arginase Inhibitor Screening Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... Total RNA extraction was performed using the SV RNA Isolation System Kit (Promega), following the manufacturers’ recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... Cytotoxicity was quantified colorimetrically with the CytoTox96 lactate dehydrogenase (LDH)-release kit (Promega). The percentage of cytotoxicity was calculated with the formula ...
-
bioRxiv - Microbiology 2021Quote: ... and genomic DNA was isolated using the Wizard Genomic DNA Purification Kit (Promega). qPCR reactions of 10 µL were set up with 5 µL PowerUpTM SYBRTM Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2020Quote: ... and chromosomal DNA was prepared using the Wizard Genomic DNA Purification Kit (Promega).
-
bioRxiv - Cancer Biology 2020Quote: Cell viability was determined by CellTiter 96 aqueous one solution proliferation kit (Promega) and/or CellCountingKit-8 (CCK-8 ...
-
bioRxiv - Cell Biology 2021Quote: ... using a CellTiter 96 AQueous One Solution Cell Proliferation Assay kit (Promega, USA). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... The luciferase activities were measured utilizing the luciferase reporter assay system kit (Promega).
-
bioRxiv - Cell Biology 2020Quote: ... the CellTiter 96® AQueous One Solution Cell Proliferation Assay kit (Promega, USA) was used following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2021Quote: ... luciferase activity was measured using a Dual-Luciferase Reporter Assay kit (Promega; E1910) with a 20/20 Luminometer (Turner Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... All cell lines have been DNA fingerprinted using the PowerPlex 1.2 kit (Promega) and were found to be mycoplasma free using the e-Myco kit (Boca Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... and luciferase assay performed using a dual luciferase chemiluminescence detection kit (Promega #E1910) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Levels of accumulated cAMP were detected with the cAMP-Glo™ kit (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... activity of both reporters was measured using the Dual-Luciferase Reporter kit (Promega) and read on a Tecan Infinite 200 PRO Reader ...
-
bioRxiv - Immunology 2022Quote: RNA was first reverse-transcribed to cDNA using GoScript Reverse Transcriptase kit (Promega) following the manufacturers protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... and the first second PCR kits were obtained from Promega (M7122, Madison, USA).
-
bioRxiv - Molecular Biology 2022Quote: ... and firefly luciferase activity was assayed using the Dual Reporter Luciferase kit (Promega).
-
bioRxiv - Synthetic Biology 2022Quote: ... Luciferase assay was performed using the Dual Luciferase Reporter Assay System kit (Promega). Bioluminescence was measured using CLARIOstar (BMG LABTech).
-
bioRxiv - Pathology 2022Quote: ... LDH activity in the supernatants was measured using CytoTox 96 kit (Promega, G1780) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted following the Maxwell 16 LEV Tissue RNA Kit protocol (Promega). For tissue-specific assays ...
-
bioRxiv - Biochemistry 2022Quote: ... using the Wizard® Genomic DNA Purification kit (Promega, Charbonnières-Les-Bains, France). The final pellet was resuspended in 40 μL of sterile ultra-high quality (UHQ ...
-
bioRxiv - Biochemistry 2022Quote: ... NFAT-luciferase activity was determined using Dual Luciferase Reporter Assay Kit (Promega E1910).
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA was robotically extracted using the Maxwell tissue RNA extraction kit (Promega) and quantified using the Nanodrop ND-1000 UV-Vis Spectrophotometer (Nanodrop technologies ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was extracted using the Wizard Genomic DNA Purification kit (Promega, A1120) following the manufacturers’ guidelines and quantified using the Nanodrop 2000 Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: Measurement of CYP3A4 enzymatic activity was performed using the P450 Glo kit (Promega). Cells were incubate with 1:1000 luciferin-IPA in Hepatozyme complete for 1h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was isolated using the Wizard® Genomic DNA Purification kit (Promega). Cells were resuspended in 100 μl of 50mM EDTA with 500U PlyC and incubated at 37 °C with shaking for 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA isolation was performed using a Wizard Genomic DNA purification kit (Promega). Plasmid isolation was performed with GenElute plasmid miniprep kit (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: Intracellular adenosine triphosphate (ATP) levels were measured using a BacTiter-Glo kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... cell lysates were collected and analysed using the dual-luciferase assay kit (Promega) following the manufacter’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was extracted using the Wizard Genomic DNA Purification kit (Promega, Madison, WI) and the Quick Gene DNA whole blood kit S (Fugifilm ...
-
bioRxiv - Neuroscience 2020Quote: LDH release was determined by the colorimetric CytoTox 96 Cytotoxicity Assay kit (Promega). After BrainSpheres infection ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was extracted carefully by Wizard® Genomic DNA Purification Kit (Promega, A1125), washed with 70% EtOH ...
-
bioRxiv - Cell Biology 2021Quote: ... after processing cells using the Dual-Glow Luciferase Assay kit (E2920 Promega, USA) 48 hours post transfection ...
-
bioRxiv - Biochemistry 2020Quote: GTPase activity assays were carried out using GTPase-Glo assay kit (Promega, V7681).
-
bioRxiv - Microbiology 2021Quote: ... the culture medium was removed and treated with caspase-1 assay kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... and the P450-Glo CYP1A2 Induction/Inhibition Assay kit (Promega, Cat. no. V8422) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... After removing the residual genomic DNA with the DNase I Kit (Promega, M6101), 500 ng of total RNA was reverse-transcribed into cDNAs using the PrimeScript RT Reagent Kit (TaKaRa ...
-
bioRxiv - Microbiology 2022Quote: ... TUNEL assay was carried out using DeadEnd Fluorometric TUNEL System kit (Promega, UK). Briefly ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA synthesis was carried out using the GoScript™ Reverse Transcription kit (Promega). cDNA was diluted 1:30 into molecular biology grade water and used as template in qRT-PCR reactions using SYBR Green (Applied Biosystems™ ...
-
bioRxiv - Neuroscience 2019Quote: Cell viability and apoptosis were measured using ApoTox-Glo Triplex assay kit (Promega) following manufacturer’s guideline with the CLARIOstar microplate reader (BMG LABTECH) ...
-
bioRxiv - Neuroscience 2019Quote: ... Intracellular cAMP levels were measured using cAMP-Glo assay kit (Promega, Madison, WI) according to the manufacturer’s instruction and quantified on a plate-reading luminometer.
-
bioRxiv - Cell Biology 2019Quote: Total cell RNA was extracted using the SV Total RNA Isolation Kit (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA was synthetized from 1µg RNA using the Reverse Transcription system kit (Promega). The qPCR reactions were performed with PowerUp™ SYBR™ Green Master Mix (Thermofisher ...
-
bioRxiv - Genomics 2019Quote: ... fluorescence was measured using the Dual-Glo Luciferase Assay Kit (Promega, Madison, WI), in which 10 μL of Dual-Glo Luciferase Reagent was added ...
-
bioRxiv - Cell Biology 2019Quote: ... All cells were authenticated by STR profiling (GenePrint 10 System kit from Promega and AuthentiFiler PCR Amplification Kit from ThermoFisher ...
-
bioRxiv - Bioengineering 2019Quote: ... cell viability was determined using a Cell Titer Aqueous One Solution kit (Promega).
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA was yielded from purified mRNA using ImProm II Reverse Transcription kit (Promega). Quantitative-RT PCR was then performed using the SensiFAST SYBR Green Hi-ROX master mix (Bioline) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Both PCR products were purified using the Wizard PCR cleanup kit (Promega, USA).
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA isolation was performed using the Wizard Genomic DNA Purification kit (Promega).
-
bioRxiv - Cancer Biology 2019Quote: ... The cAMP assay was performed using the cAMP-Glo™ Assay Kit (Promega) according to the manufacturer’s instructions ...