Labshake search
Citations for Promega :
1601 - 1650 of 2957 citations for 1 1 Dimethylsila 11 Crown 4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG antibody (1:10000) (Promega, Madison, WI, USA), diluted in 3% (w/v ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were again diluted to 2 M urea and digested with 1 µg trypsin (Promega) (1/100 ...
-
bioRxiv - Biochemistry 2024Quote: ... Then membranes were incubated with secondary anti-rabbit IgG horse radish peroxidase (Promega, 1:5000) for 1 hour ...
-
bioRxiv - Systems Biology 2023Quote: The transfections were performed with a 1 mg DNA: 2 ml Fugene HD (Promega E2311) ratio ...
-
bioRxiv - Biochemistry 2023Quote: ... The blot was probed with 1:1000 dilution of anti-NLuc antibody (Promega cat#7000) and the bands detected by chemiluminescent detection.
-
bioRxiv - Developmental Biology 2022Quote: ... The 50μg of proteins were then trypsin digested overnight at 37 °C (1:25; Promega) using the filter aided sample preparation (FASP ...
-
bioRxiv - Cancer Biology 2022Quote: ... PD-L1 neutralization was done in a PD-1/PD-L1 Blockade Bioassay (J1250, Promega).
-
bioRxiv - Cell Biology 2022Quote: ... or secondary antibodies: anti-mouse IgG horseradish peroxidase (HRP) (Promega, Madison, WI, W402B, 1:10,000), anti-rabbit IgG HRP (Promega ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1 µl of crude DNA lysate was used with 2x GoTaq Reaction Mix (Promega M7123) supplemented with 5% DMSO.
-
bioRxiv - Immunology 2022Quote: ... 24 h following stimulation with IFN cells were harvested in 1 × passive lysis buffer (Promega) and stored at −20°C ...
-
bioRxiv - Microbiology 2023Quote: Viral loads were quantified using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-COV-2 the nCOV_N1 primer/probe mix from the SARS-CoV-2 (2019-nCoV ...
-
bioRxiv - Biophysics 2023Quote: ... Cross-linked samples for XL-MS were digested by 1:50 (m/m) trypsin (Promega) overnight at 37 °C while shaking at 600 rpm ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA (1 μg per reaction) was reverse transcribed using the GoScript Reverse Transcription System (Promega). Following reverse transcription ...
-
bioRxiv - Immunology 2023Quote: ... Complementary DNA (cDNA) was generated using 1 μg RNA using M-MLV Reverse Transcriptase (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were digested overnight at 37° C with 1 μg mass spectrometry grade Trypsin (Promega). The resulting peptide sample was acidified with 10% formic acid and 10% trifluoroacetic acid (TFA ...
-
bioRxiv - Cell Biology 2024Quote: ... and samples were digested with 1:15 mass ratio of Sequencing Grade Modified Trypsin (Promega) using an S-trap mini device (Protifi ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then placed in a 50 mL solution of 1 ×Diamond Nucleic Acid Dye (Promega) in 0.2 ×TBE buffer pH 7.6 to rock in the dark for 30 min ...
-
bioRxiv - Biochemistry 2024Quote: ... Trypsin was added at a 1:20 enzyme-to-ribosome ratio (2.5 µg; Promega, V5111) following incubation ON ...
-
bioRxiv - Microbiology 2024Quote: ... The membranes were incubated with HRP-conjugated goat anti-rabbit IgG (1:8000; Promega, USA) as the secondary antibody ...
-
bioRxiv - Biochemistry 2024Quote: ... Trypsin digestion was performed with a 1 μg /μL trypsin solution (Trypsin Gold, V528A, Promega) at a ratio of 1:50 at 37 °C for 16 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... Ten ml of conditioned media was treated with 1 ml Proteinase K (Promega Cat # V3021) in buffer (10 mM Tris-Cl pH8.0 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 25 µL digestion buffer was added (1 µg sequencing grade modified trypsin (Promega, V511A) in 50 mM TEAB) ...
-
bioRxiv - Bioengineering 2024Quote: ... A complex of 1 μg of plasmid was mixed with 3 μl of Viafect (Promega) in OPTI-MEM and mixed and incubated at room temperature for 20 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were digested with trypsin (1/100, w/w, Sequencing Grade Modified Trypsin, Porcine; Promega) overnight ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 μM of FabH (Human Kappa) was immobilized on 200 μl SA magnetic beads (Promega) and incubated with 1 mL phage library for 1 hour at room temperature with gentle shaking ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by secondary antibody diluted 1: 2500 in blocking solution (HRP-conjugated anti-Rabbit, Promega). Chemiluminescence was revealed with ECL Clarity (BioRad ...
-
bioRxiv - Biochemistry 2024Quote: ... and the proteins were digested overnight at 37°C using 100:1 protein:trypsin ratio (Promega). After digestion ...
-
bioRxiv - Bioengineering 2024Quote: ... with the luciferin conjugated specific CYP3A (1:40) substrate (P450 P-Glo Luminescence Kit, Promega) at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... The secondary antibodies used were anti-mouse IgG-HRP (cat #W4028, Promega, 1:10000 dilution), anti-rabbit IgG-HRP (cat#W4018 ...
-
bioRxiv - Cell Biology 2024Quote: ... resuspended in Hank’s buffered salt solution (HBSS) containing NanoGlo Live Cell Reagent (1:20; Promega) with furimazine ...
-
bioRxiv - Cancer Biology 2024Quote: ... The samples were then digested with trypsin at a ratio of 1:50 (Promega #V5111) over night at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... The sample was digested overnight with 2.5 µl of 1 µg/µl trypsin (Promega V528A) at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... cDNA were synthesized from RNA (4 μg) using AMV Reverse Transcriptase (Promega). ...
-
bioRxiv - Immunology 2021Quote: CTLA-4 Blockade Bioassay was purchased from Promega (JA3001; Madison, WI, USA) and performed according to the manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2020Quote: ... initially for 4 hours with 1.5 μl trypsin (0.5 μg/μl; Promega) and then another 1-2 hours with 0.5 μl additional trypsin ...
-
bioRxiv - Bioengineering 2023Quote: ... 5 µL reactions were made by adding 4 µL LgBiT (Promega, N1120), 0.5 µL 100 µM p86-R4 (Vivitide ...
-
bioRxiv - Systems Biology 2023Quote: ... initially for 4 hours with 1.5 μl trypsin (0.5 μg/μl; Promega) and then another 1–2 hours with 0.5 μl additional trypsin ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were digested with 4 ug Trypsin/Lys-C mix (Promega V5073) for 3-4 hrs at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 µL furimazine (0.36% vol/ vol diluted in BRET assay buffer, Promega) was added before readout on ClarioStar.
-
bioRxiv - Cell Biology 2023Quote: ... After addition of 4 μl of RNAsin Plus ribonuclease inhibitor (Promega N2611), the samples were spun down ...
-
bioRxiv - Neuroscience 2023Quote: ... to an agar block (4% agarose, low melting point, analytical grade, Promega, Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were then digested with 4 μg of Trypsin/lys-C (Promega) overnight at 37°C before being collected by centrifugation with washes of 100mM Tetraethylammonium bromide ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by 4 µg of sequencing-grade LysC (Wako) and trypsin (Promega) for overnight incubation at 37°C ...
-
bioRxiv - Biophysics 2020Quote: CosM6 cells were transfected with ∼1 µg of wild type or mutant constructs using FuGENE6 (Promega) and were patched within 1-2 days after transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized from 1 μg of each RNA sample using Oligo(dT)15 Primer (Promega) and M-MLV Reverse Transcriptase (RNase H Minus ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µL cDNA was used as template for 25 cycles of PCR using GoTaq polymerase (Promega) targeting the TMV replicase using forward primer 5’ CCGCGAATCTTATGTGGAAT 3’ and reverse primer 5’ TCCTCCAAGTGTTCCCAATC 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... A 1:10 solution of sample homogenate to colentrazine was analyzed on a GloMax Explorer (Promega).
-
bioRxiv - Neuroscience 2022Quote: ... using 0.5 - 1 μg of cDNA and FuGene as per the manufacturer’s instructions (Promega, Madison, WI). Cells were fixed for immunocytochemistry 24 or 48 h after transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1.33 μL 1 M Tris-HCL pH 8.5 and 7.8 μL 0.5 mg/mL trypsin (Promega) were added and proteins left to digest for 16 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were diluted with 875uL of 50mM Tris buffer along with Trypsin (1:100, Promega #V511C) for overnight digestion ...