Labshake search
Citations for Promega :
1551 - 1600 of 1701 citations for 7 8 Dihydroisoquinolin 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... UDP (at concentrations ranging from 1 nM to 1 mM) was then applied with a final concentration of 5 μM furimazine (NanoLuc Luciferase Assay, Promega). Luminescence was subsequently measured using a Victor X5 multi-label plate reader (PerkinElmer).
-
bioRxiv - Microbiology 2023Quote: ... 5% CO2 before measurement of Renilla and Firefly luciferase activities using Dual-Glo® Luciferase Assay System (Promega, Cat #E2920) and Tecan SPARK plate reader ...
-
bioRxiv - Microbiology 2023Quote: ... were made by replacing the ORF3 region encoding 5–105 amino acids with an in-frame insertion downstream of 4th VP2 codon sequence of UnaG and NanoLuc (Promega) coding regions with their own stop codons ...
-
bioRxiv - Neuroscience 2023Quote: Surface expression was measured using a HiBit-tagged 5-HT2A receptor and the Nano-Glo HiBit Extracellular Detection System (Promega). N-terminal HiBit-tagged human 5-HT2A receptor was cloned into pcDNA3.1 using Gibson Assembly ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... was co-transfected at a 1:5 ratio with either the HaloTag-ubiquitin plasmid (expressing Ub-Halo) or the HaloTag control (Promega). Transfected cells were incubated for 20 h at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: The RNase III.RNA complexes were washed and the 5′ ends of bound RNAs were dephosphorylated with the addition of thermosensitive alkaline phosphatase (Promega). RNA was radiolabelled by phosphorylation with T4 PNK (Sigma-aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Microbiology 2023Quote: ... and genomic DNA was isolated from overnight cultures (5 mL) using the Wizard Genomic DNA Purification Kit (Promega GmbH, Walldorf) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were diluted 5-fold with 25 mM Tris pH 8.0 and 1 mM CaCl2 prior to digesting them with trypsin (Promega, V511X) at a 1:30 enzyme-to-protein ratio at 37 °C in a dry bath for 16 h.
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... dehydrated with 0.2 mL of 100% acetonitrile and rehydrated with 5 μL of the digestion solution containing 15 μg/mL sequencing-grade trypsin (Promega) in 20 mM aqueous solution of NH4HCO3 ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with or without 50 μM adenosine 5′-triphosphate (ATP) at 30 °C for 30 minutes followed by kinase assays using ADP-Glo Kinase Assay kit (Promega). Data were analyzed using GraphPad Prism 9 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5×104 cells/well were seeded in 24-well plates and transfected with 10 ng pRL-CMV (Promega, Walldorf, Germany) together with either 250 ng pSuper8xTOPFlash or 250 ng pSuper8xFOPFlash [22] using the FuGENE6® reagent (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 mM KCl, 5 mM MgCl2, 2 mM DTT, 100 μg ml-1 cycloheximide, and 20 U ml-1 RNase inhibitor [Promega].) Gradients were centrifuged 36,000 rpm for 2.5 h in a SW41 Ti rotor (Beckman Coulter ...
-
bioRxiv - Cell Biology 2022Quote: ... Tris 50mM pH8.0 and samples were heated 5 min at 90°C before digestion in a mix of 500 ng of LysC (Promega) at 37°C for 2h ...
-
Disruption of the Aspergillus fumigatus RNA interference machinery alters the conidial transcriptomebioRxiv - Microbiology 2023Quote: ... Protein precipitates were resolubilized in 5% trifluoroethanol of aqueous 100 mM TEAB and digested for 18 h with Trypsin+LysC (Promega) at a ratio of 25:1 protein:protease ...
-
bioRxiv - Microbiology 2022Quote: ... cells were co-transfected with RIG-I-2CARD (5 ng) and lysed at 24 hours after transfection using Passive Lysis Buffer (Promega). Samples were processed and luciferase activity was measured using the Dual-Luciferase Assay System (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were maintained at 37 °C and 5% CO2.Cell lines were authenticated using Short Tandem Repeat fingerprinting carried out using the GenePrint 10 system (Promega). For 3D spheroids ...
-
bioRxiv - Molecular Biology 2023Quote: ... The final 50 µL translation reaction included the 5 µL RNA mixture described above and components from the Rabbit Reticulocyte Lysate system (Promega): 35 µL of rabbit reticulocyte lysate ...
-
bioRxiv - Biochemistry 2023Quote: ... The first-strand cDNA was synthesized from 5 µg of the total RNA with an oligo (dT) primer using the AMV reverse transcriptase (Promega). A polymerase chain reaction (PCR ...
-
FACS-Sortable Picoreactors for Ultra High-throughput Screening of Catalysts in Biphasic EnvironmentsbioRxiv - Bioengineering 2024Quote: ... emulsions of octanol + 5% (w/v) Span 80 + 40 µM Nile Red in an aqueous phase of nuclease free water (Promega) + 200 ng/µL miniprepped plasmid + 5% (w/v ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR reactions were conducted in 10 μL volume comprising 5 μL Promega 2x PCR Master Mix (Promega, Madison, Wisconsin, USA), 10 pmol of forward and reverse primers ...
-
bioRxiv - Microbiology 2023Quote: ... The viability of Vero cells treated with 5-FU and EIDD-1931 alone were assessed using CellTiter-Glo Viability Assay (Promega).
-
bioRxiv - Molecular Biology 2024Quote: ... 40 µL of digestion solution (1.25 mM TCEP, 5 mM chloroacetamide, 0.2 µg trypsin/Lys-C mix (Promega, cat#V5073), in 100 mM HEPES pH 8.5 ...
-
bioRxiv - Molecular Biology 2024Quote: About 5 μg empty pcDNA3 vector or ZNF410 full-length and ZNF410-ZF plasmids was transiently transfected with FuGENE 6 (Promega) into 10 cm plates of COS-7 cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were treated 24h after seeding and cell viability was assessed 5 days after treatment using the Cell Titer-Glo luminescent cell viability assay (Promega). Cells treated with vehicle control DMSO (0.1% ...
-
bioRxiv - Neuroscience 2024Quote: ... The Renilla luciferase activity associated with WT or uORF-mutated 5’UTRs was measured according to the manual of the Dual-Luciferase Reporter Assay System (Promega) 32 h after transfection and was normalized to the activity of firefly luciferase.
-
bioRxiv - Biophysics 2024Quote: ... was incorporated at the 5’ end of the FL open reading frame during PCR amplification from a pRL-CMV vector (Promega). A Kozak consensus sequence and a 50-nucleotide upstream region was incorporated before the translation start site to ensure enough space for the assembly of translation initiation complex77 ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... The inoculum was added to HEK293T cells and incubated at 37 ° C with 5% CO2 and the luciferase signal was with analyzed using luciferase assay kit (Promega).
-
bioRxiv - Molecular Biology 2020Quote: First strand synthesis was performed in 25 μl reaction volumes using 5 μl of MMLV-RT 5X buffer (Promega, Wisconsin, UK), 1.25 μl of dNTPs (10mM ...
-
bioRxiv - Molecular Biology 2021Quote: ... Firefly luciferase activity was measured by adding 25 μL Luciferase Assay Buffer II (LARII) to 5 μL of lysate and measured immediately with the GloMax 20/20 Luminometer (Promega, E5311). Reactions were stopped and Renilla luciferase activity was measured by adding 25 μL Stop&Go reagent ...
-
bioRxiv - Microbiology 2019Quote: ... proteins were firstly digested for 5 h at 37°C with 250 ng rLys-C Mass Spec Grade (Promega, Madison, USA). Samples were then diluted 4-fold with 100 mM Tris HCl pH 8.5 to reach a concentration of 2M urea and then re-incubated overnight at 37°C with 1 µg Sequencing Grade Modified Trypsin (Promega ...
-
bioRxiv - Cancer Biology 2020Quote: CellTiter 96 AQueous One Solution Cell Proliferation Assay MTS 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) was used according to the manufacturer’s protocol (Promega, Madison, WI) to assess proliferation of cells cultured in 96-well plates.
-
bioRxiv - Biochemistry 2019Quote: ... Plates were then incubated at 37°C and 5% CO2 for 48 hours upon which cell viability was assessed by adding CellTiter-Glo® (Promega) to the reaction ...
-
bioRxiv - Cancer Biology 2020Quote: ... 25uL of reconstituted CellTiter-Glo Luminescent Cell Viability reagent was added to each well and incubated for 5 minutes (Promega, G7571). Luminescence readings were taken using the BioTek Synergy H1 Hybrid Reader ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated at 37°C (5% CO2) for 48 h before performing CellTiter-Glo (CTG) assays as per the manufacturer’s instruction (Promega, Madison, WI). Luminescence was read on a BioTek Synergy HTX plate reader (BioTek Instruments Inc. ...
-
bioRxiv - Biochemistry 2021Quote: ... The gel particles were eventually rehydrated on ice in a solution containing 5 ng/μL of trypsin (Promega, modified sequencing grade) in 50 mM NH4HCO3 ...
-
bioRxiv - Cell Biology 2020Quote: ... at 3500 cells/well and cell proliferation over 3-5 day periods was determined by measuring luminescence with CellTiter-Glo® assay kit (G7570, Promega), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The plates were cultured for two days at 37°C with 5% CO2 after which the supernatant was removed and replaced with 50 μl Nano-Glo Luciferase Substrate (Promega, Inc.). Light emission was measured in an Envision 2103 Multi-label plate reader (PerkinElmer ...
-
bioRxiv - Plant Biology 2020Quote: ... Individual reactions conducted with UGA-CPES consisted of a 10 µL mixture containing 5 µL of GoTaq Green Master Mix 2X (Promega Corporation), 0.5 µL of template DNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... The α-tub∷GFP (Chung et al., 2014) plasmid was injected at 5-10ng/μl after purification using the PureYield Midiprep kit (Promega, #A2492).
-
bioRxiv - Biophysics 2022Quote: ... Blots were incubated with secondary antibodies for 1h at room-temperature (1:10000 in 5% skim-milk powder, anti-rb-HRP-conjugate (Promgea, W401B)/anti-ms-HRP-conjugate (Promega, W402B)) ...
-
bioRxiv - Biochemistry 2022Quote: The crRNA (5’-AAUUUCUACUGUUGUAGAUGUGAUAAGUGGAAUGCCAUGUGGG-3’) was synthesized and purified using the T7 RiboMAX™ Express Large Scale RNA Production System (Promega). The following DNA templates were used for the in vitro transcription reaction ...
-
bioRxiv - Genomics 2022Quote: ... Membranes were washed in TBST and probed with anti-mouse HRP secondary antibody (Promega; 1:2,000 in 5% BSA in TBST) for 1 hour at room temperature followed by development in ECL (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from 5 mL of overnight cultures using the Wizard Genomic DNA Purification Kit (Promega Corp., Madison, WI, USA) and DNA concentration was measured using a Qubit™ Fluorometer and Nanodrop 2000 (Thermo Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Bright-Glo reagent was added to the plate and incubated at room temperature for 5 min before measuring luminescence on a GloMax 96 luminometer (Promega, USA), with titers given in Relative Light Units (RLU ...
-
bioRxiv - Microbiology 2021Quote: ... for 5 min while orbital shaking and using 20 μL of lysate with 20 μL of Luciferase Kit substrate (Promega, E1501).
-
bioRxiv - Microbiology 2021Quote: ... an 150 µL aliquot of the protein sample was digested with 5 µg of sequencing grade trypsin (Promega, Madison, WI, USA) overnight at 37°C.