Labshake search
Citations for Promega :
1551 - 1600 of 3609 citations for 4 2 Hydroxy 1 Methoxyethyl 1 2 Benzenediol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and anti-rabbit IgG HRP (Promega, WB 1:10000).
-
bioRxiv - Immunology 2020Quote: ... 1 µl RNAsin Plus RNAse inhibitor (10K, Promega AG), 1 µl Superscript III (200 U/ml ...
-
bioRxiv - Microbiology 2020Quote: ... cells were collected in 1× passive lysis buffer (Promega). Lysates were assayed for luciferase activity using the Dual Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Immunology 2020Quote: ... 1 U/µl of RNasin plus RNase inhibitor (Promega) and passed through a 25-gauge 5/8 needle attached to 1ml syringe 10 times ...
-
bioRxiv - Synthetic Biology 2022Quote: ... a 1:50 dilution of FluoroTect™ GreenLys (Promega) was added to the reaction before incubation.
-
bioRxiv - Molecular Biology 2022Quote: 1 ml nuclease-untreated Rabbit Reticulocyte Lysate (Promega L4151) was supplemented with 25 µM haemin ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-cleaved Caspase-3 (1:500 dilution, Promega), mouse anti-GFP (1:1,000 dilution ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 U/mL of RNasin Plus RNase Inhibitor (Promega)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.1% IGEPAL CA-630 (Sigma I8896)] supplemented with 1U µl-1 RNasin Plus (Promega N2611). In parallel ...
-
bioRxiv - Molecular Biology 2021Quote: ... the GoTaq® 1-Step RT-qPCR System (Promega) was used with the primers (F ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... digested with trypsin (1:25w/w) (Promega, WI, USA) for 15 h at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... and digested with trypsin (50:1 protein:enzyme ratio, Promega) overnight ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and subsequently digested using 1:25 trypsin (V5113, Promega): protein at 37 C with constant mixing using a thermomixer ...
-
bioRxiv - Immunology 2021Quote: ... and 1 μg shRNA plasmid using Fugene 6 (Promega). The next day ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-β-Gal (1:1000, Promega, Cat#: Z3781), rabbit anti-β-galactosidase (1:5000 ...
-
bioRxiv - Genetics 2020Quote: ... Thereafter 1 μg of sequencing grade modified Trypsin (Promega) was added to each sample (1:33 trypsin:protein ...
-
bioRxiv - Cell Biology 2020Quote: ... with 1 mM EDTA (Promega Life Sciences, USA, #V4231) and 100 mM Tris-HCl pH 7.5 (Quality Biological ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-rabbit (1/20000, Promega, W4021 and W4011, respectively) and anti-rat (1/10000 ...
-
bioRxiv - Biochemistry 2021Quote: ... and GoTaq® 1-Step RT-qPCR System (Promega) were used for RT-qPCR ...
-
bioRxiv - Biochemistry 2021Quote: ... supplemented with 1 U/μl RNase inhibitor (RNaseIn, Promega), 20 μM amino acid mix (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAsin Plus RNase inhibitors were added (1:1,000, Promega). Following secondary antibody incubation ...
-
Targeting properdin - Structure and function of a novel family of tick-derived complement inhibitorsbioRxiv - Immunology 2021Quote: ... Secondary antibody (donkey α-goat HRP, Promega, 1:10,000). For His-tagged proteins ...
-
bioRxiv - Biochemistry 2022Quote: ... and 1 μG of sequencing grade trypsin (Promega, V5111) was added for 18 h at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-β-galactosidase (1:1,000, Promega, Cat#: Z3781), rabbit anti-β-galactosidase (1:5,000 ...
-
bioRxiv - Microbiology 2022Quote: ... with 1:500 Enduren luciferase substrate (Promega, Madison, WI) added ...
-
bioRxiv - Biochemistry 2022Quote: ... proteins were digested with 1) chymotrypsin (Promega, Madison, USA), 2 ...
-
bioRxiv - Microbiology 2022Quote: ... and 120 μL 30 mg mL-1 lysozyme (Promega), followed by 30 min incubation at 35 °C ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 µL RNasin® Ribonuclease Inhibitor (Promega Part # N211A), with 5 µl 5X First Strand Buffer (Invitrogen Catalog Number 18067017 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 1 µL of CellTiter-Fluor™ (Promega, Madison, Wisconsin) was added using a BioRAPTR FRD™ ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 1 µL of CellTiter-Fluor™ (Promega, Madison, Wisconsin) was added using a BioRAPTR FRD™ ...
-
Arc mediates intercellular synaptic plasticity via IRSp53-dependent extracellular vesicle biogenesisbioRxiv - Neuroscience 2024Quote: ... Fractions were complemented using LgBiT (Promega, 1:200 dilution) and nanoluc substrate (Promega ...
-
bioRxiv - Systems Biology 2024Quote: ... Then 1 µg of sequencing grade modified trypsin (Promega) was added to the samples and incubated for 16 h at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg of sequencing grade trypsin (Promega, Wisconsin, USA) was added and samples were incubated at 37 °C overnight.
-
bioRxiv - Neuroscience 2024Quote: ... then digested with trypsin (Promega, 1:50 w/w) overnight at 37ºC ...
-
bioRxiv - Cell Biology 2024Quote: ... for 3 h and with trypsin (1:25, Promega) for 16 h both at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... containing trypsin (Promega; final 1/100 enzyme/protein ratio) and LysC (Wako ...
-
bioRxiv - Cell Biology 2024Quote: ... then digested with trypsin (Promega, 1:50 w/w) overnight at 37ºC ...
-
bioRxiv - Biochemistry 2024Quote: ... to reach 1% vol/vol as recommended by Promega, then mixed with YZ-01-A (final DMSO 1% vol/ vol ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mM CaCl2 and sequencing grade trypsin (Promega, WI) was added to all protein samples at a 1:50 (w/w ...
-
bioRxiv - Microbiology 2023Quote: ... and the addition of 1:1000 Nano-Glo (Promega). The bioluminescent signal was measured using a CLARIOstar luminometer (BMG Labtech ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg of RNA treated with DNase (RQ1, Promega) was reverse-transcribed by Superscript III (Life Technologies) ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 unit of Taq polymerase (Promega, Madison, WI, USA), and approximately 75 ng of schistosome genomic DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... then with trypsin (Promega, 1:50 (protease to protein)) for 6 hours on a 37 °C shaker.
-
bioRxiv - Biochemistry 2023Quote: ... 1 U/µL Rnasin® Plus RNAse inhibitor (Promega), 2 mM DTT ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse Anti-β-Galactosidase (#Z3781, 1:200) from Promega; rabbit anti-SWS (1:1000 from Doris Kretzschmar) ...
-
bioRxiv - Microbiology 2023Quote: ... which were digested with 1 µg Lys-C (Promega) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and anti- mouse IgG antibody (1:1,000, #S3721, Promega).
-
bioRxiv - Neuroscience 2023Quote: ... and goat anti-mouse IgG (1:5,000; W4011, Promega) antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-p-JNK (pTPpY, Promega, USA-1:100 dilution); 8 ...
-
bioRxiv - Microbiology 2023Quote: ... using SYBR Green GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...