Labshake search
Citations for Promega :
1551 - 1600 of 2107 citations for 3 Ethyl 3 methyloxolane 2 5 dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Blots were washed 3 times in TBST for 5 minutes and were then incubated with HRP-conjugated secondary anti-mouse-IgG-H&L chain (Promega) or anti-rabbit-IgG-F(ab’)2 (GE Healthcare ...
-
bioRxiv - Plant Biology 2021Quote: ... Halo fusion proteins were produced from 1.5 µg plasmid DNA in a 15 µL reaction using TNT SP6 High-Yield Wheat Germ Protein Expression System (Promega). Protein expression was confirmed by Western blot with Anti-HaloTag monoclonal Ab (1:2000 ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were sonicated for 30 seconds before centrifugation and 5 μl of the supernatants were collected for luciferase expression reading by the dual-luciferase reporter assay system (Promega) using a GLOMAX 20/20 luminometer (Promega) ...
-
bioRxiv - Immunology 2021Quote: ... cells13 for 48 hours after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR mixture was at a volume of 10 μL containing 5 μL SYBR Premix Ex Taq (Promega, Madison, USA), 0.5 μM each of the primers ...
-
bioRxiv - Cell Biology 2021Quote: ... the antibody–bead mixture was resuspended in 500 μl of the reaction mixture containing 10 μg of fragmented total RNA,100 μl of reaction buffer and 5 μl of RNasin Plus RNase Inhibitor (Promega), and incubated for at least 4 h at 4 °C ...
-
bioRxiv - Biophysics 2020Quote: ... 1 mM EGTA, 5% glycerol) and freshly supplemented reagents (1 mM DTT, 1 mM ATP, 1 mM PMSF, protease inhibitor mix (Promega) and 1% Tween 20) ...
-
bioRxiv - Biophysics 2020Quote: ... Proteins were digested to peptides by addition of 25 μl of 50 mM ammonium bicarbonate containing 5 μg of trypsin (Promega) and incubating (37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The remaining iodoacetamide was quenched by adding 5 mM DTT and the proteins were digested with 150 ng trypsin (Trypsin Gold, Promega) for 90 min at room temperature in the dark ...
-
bioRxiv - Biochemistry 2022Quote: ... Remaining iodoacetamide was quenched by adding 5 mM DTT and the proteins were digested with 200 ng trypsin (Trypsin Gold, Promega) at 37 °C ON ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were diluted with ddH2O 1:5 and proteins were digested for 20 h at 37°C using trypsin (Trypsin Gold, Promega) at an enzyme/protein ratio of 1:50 ...
-
bioRxiv - Biochemistry 2022Quote: ... which had been pre-incubated in 200 μL Ex-Cell 420 medium plus 5 μL FuGENE HD transfection reagent (Promega) for 20 minutes at 27 °C ...
-
bioRxiv - Immunology 2022Quote: ... cells9 for 48 hours after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Immunology 2022Quote: ... for 48 h after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μg of the purified RNA was further treated in solution by 5 units of RQ1 DNase in 100 μl of 1x RQ1 buffer (Promega) for 1 h at 37°C ...
-
bioRxiv - Immunology 2022Quote: The genomic DNA of the 5 assessed M strains were isolated and purified using the Wizard Genomic DNA Purification Kit (Promega). The growing of strains ...
-
bioRxiv - Neuroscience 2020Quote: ... Whole mount in situ hybridization was performed as previously described 55 with the following modifications: 5 dpf larvae were permeabilized by digesting with Proteinase K (10ug/ml, Promega) for 2 hours ...
-
bioRxiv - Microbiology 2020Quote: ... The plates were washed with PBS-T 5 times and a 1:5000 dilution of HRP-conjugated goat anti-rabbit IgG antibody (Promega) was added for 45 min at 37 □ ...
-
bioRxiv - Molecular Biology 2020Quote: ... and rehydrated with 5 μL of digestion solution containing 20 mM ammonium bicarbonate and 15 ng/μL sequencing grade trypsin (Promega). Digestion was carried out at 37°C for 6 h ...
-
bioRxiv - Cell Biology 2020Quote: ... and the proteins were on-bead digested using 5 µl of Sequencing Grade Trypsin (100 ng/µl in 10 mM HCl, Promega). The digestion was carried out at 37°C over night ...
-
bioRxiv - Microbiology 2021Quote: ... where the multiple cloning site had been replaced by a synthetic construct (Genewiz) composed of a 5’ HiBiT tag (Promega), a new multiple cloning site and 3’ 3xHA tag ...
-
bioRxiv - Cancer Biology 2021Quote: ... 293T cells were transfected with 8xTEAD synthetic YAP/TAZ-responsive promoter-luciferase reporter and treated with BSA or recombinant TNC (5 µg/mL) for 48 h to measure YAP1 signaling activity using Dual-luciferase Reporter Assay Kit (Promega).
-
bioRxiv - Immunology 2021Quote: ... Wells were then washed 5 times with wash buffer and the remaining bound cells were detected with the CellTiterGlo kit (Promega) as per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: Halo-MDC1 deletion mutants were expressed transiently by transfecting ∼ 5 × 105 cells with 1 µg of plasmid DNA using FuGene 6 (Promega). For genome editing ...
-
bioRxiv - Microbiology 2022Quote: ... was added to the plate and incubated at room temperature for 5 min before measuring luminescence on a GloMax 96 luminometer (Promega).
-
bioRxiv - Immunology 2022Quote: ... for 48 hours after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... between 0.5 to 1 µg of total RNA was reverse transcribed into cDNA using an ImProm II Reverse Transcriptase kit (Promega). Equal amounts of cDNA were quantified by RT-qPCR using the IQ SYBR green Supermix (Bio-Rad ...
-
bioRxiv - Genetics 2020Quote: ... double-stranded DNA oligos containing KRAB-ZFP target sequences (Supplemental Table 5) were cloned upstream of the SV40 promoter of the pGL3-Promoter vector (Promega) between the restriction sites for NheI and XhoI ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were grown in 5 mL LB medium overnight and plasmid DNA was isolated using the PureYield Plasmid Miniprep System (Promega). The plasmids were further tested by a restriction enzyme digestion analysis ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μL of a solution that is 1 mM in each of the 20 essential amino acids (Promega, No. L4461); 20 μl of Promega S30 Premix without Amino Acids (No ...
-
bioRxiv - Immunology 2021Quote: ... The mixture was subsequently incubated with 293TAce2 cells for 48 h after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Plant Biology 2021Quote: ... For SlTPD1 a 284 bp DNA fragment from the 5’ coding region was amplified by PCR using cDNA from flowers and cloned into the pGEM-T Easy vector (Promega). For TomA5B and SlSDS genes ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was isolated from approximately 5×105 cells using the ReliaPrepTM RNA Cell Miniprep System (Promega, UK, Cat. Z6012) following product guidelines ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were harvested day 1 and day 5 post-infection using a CellTiter-Glo Luminescent Cell Viability Assay Kit (Promega) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... At 48 h later the cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Immunology 2021Quote: ... extensively washed to remove unbound virus and co-cultured with Huh7.5 for 5 days at 37°C after which they were analyzed for with the Luciferase assay system (Promega, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Huh7.5.1 cells were infected with MLB1 and MLB2 astroviruses (MOI 5) in the presence or absence of 20 µM z-VAD-fmk (pan-caspase inhibitor, Promega). At indicated time post infection ...
-
bioRxiv - Developmental Biology 2022Quote: ... Proteins were on-bead digested using 5 μl of Sequencing Grade Trypsin (100 ng/μl in 10 mM HCl, Promega). The digestion was carried out in a microwave instrument (Discover System ...
-
bioRxiv - Molecular Biology 2022Quote: ... from the EPO gene enhancer (sequence: tcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgttcgaagccctacgtgctgtctcacacagccttct gatctcgacctaccggccgttcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgt) into the 5’ of the minimal TATA-box promoter in the pGL4.23 [luc2/minP] vector (Promega #E841A). A control pHRL-TK vector (Promega #E2241 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Flies were placed individually in 100 ul Chelex solution (5g of Chelex mixed with 95ml TE buffer) with 5 ul proteinase K (Promega), and incubated overnight at 56°C ...
-
bioRxiv - Biochemistry 2022Quote: ... 1.7 μg of attB-hACE2-mNG2-1-10 plasmid or attB-S-mNG2-11 plasmid were added into 5 μL FuGENE 6 transfection reagent (Promega) and OptiMEM (Gibco ...
-
bioRxiv - Immunology 2022Quote: ... or HT1080/Ace2 cl14 cells (for all variant neutralization assays) for 48 hours after which cells were washed with PBS and lysedwith Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysateswas measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Plant Biology 2022Quote: The dual luciferase assay (Figure 1 – figure supplement 5) was based on the Dual- Luciferase® reporter assay system (Promega). N ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Kinase activity of phosphorylated CDK2 with cyclin A and varying amounts of inhibitor (dinaciclib or 5) were measured using the ADP-Glo Kinase Assay (Promega) in a luminescence plate reader (Tecan Infinite M1000 PRO) ...
-
bioRxiv - Neuroscience 2022Quote: ... Flag-tagged STAU1 or STAU1RBDΔ3 or Flag plasmids with the wildtype or mutant 5’UTR-MTOR-LUC or luciferase empty vector constructs and Renilla luciferase plasmid (pRL-SV40 vector, Promega) according to an experimental set-up ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein precipitates were resolubilized in 5% trifluoroethanol of aqueous 100 mM TEAB and digested overnight (18 hours) with a Trypsin+LysC mixture (Promega) at a protein to protease ratio of 25:1 ...
-
bioRxiv - Biochemistry 2022Quote: ... with 10 ng pGL4.32[luc2P/NF-κB-RE/Hygro] (NF-κB response element-dependent firefly luciferase) or pGL4 [luc2P/AP-1-RE/Hygro] and 5 ng pRL-TK using the Dual Luciferase Reporter Assay (Promega). 24 hours post transfection ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR reactions were conducted in 10 μL volume comprising 5 μL Promega 2x PCR Master Mix (Promega, Madison, Wisconsin, USA), 10 pmol of forward and reverse primers ...
-
bioRxiv - Microbiology 2023Quote: ... The viability of Vero cells treated with 5-FU and EIDD-1931 alone were assessed using CellTiter-Glo Viability Assay (Promega).
-
bioRxiv - Molecular Biology 2024Quote: ... 40 µL of digestion solution (1.25 mM TCEP, 5 mM chloroacetamide, 0.2 µg trypsin/Lys-C mix (Promega, cat#V5073), in 100 mM HEPES pH 8.5 ...