Labshake search
Citations for Promega :
1551 - 1600 of 1776 citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: IP and pull-down probes of DG NSCs were subjected to on-bead digestion (Hubner et al., 2010) by trypsin (5 µg/ml, Promega) in 1.6 M Urea / 0.1 M Ammonium bicarbonate buffer at 27 C for 30 minutes ...
-
bioRxiv - Genomics 2020Quote: ... 500 cells were plated in each well of 96-well-plate and each sample had 6 replicates and monitored for 6 days from day 0 to day 5 by CellTiter-Glo 2.0 Assay (Promega, G9242) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 40% confluent HAP 1 WT cells (seeded in a 10-cm dish) were co-transfected with the two plasmids described above (5 µg each) using 30 µl Fugene6 transfection reagent (Promega) in OptiMEM medium ...
-
bioRxiv - Cell Biology 2020Quote: ... Remaining iodoacetamide was quenched by adding 5 mM DTT and the proteins were digested with 150 ng trypsin (Trypsin Gold, Promega) at room temperature for 90 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 20 pmols of folded pre-tRNA substrate was incubated with a final concentration of 5 U ml−1 RNasin plus inhibitor (Promega), 5 mM ATP and 8 pmols of TSEN complex in a final reaction volume of 20 μl for 1 h at 30 °C ...
-
bioRxiv - Bioengineering 2021Quote: ... Ligations of the digested plasmid backbones and PCR products occurred for 5-10 minutes at RT using T4 DNA ligase (Promega) prior to transformation into NEB® Turbo Competent E ...
-
bioRxiv - Biochemistry 2021Quote: The samples were reduced and digested in 25 μL co-IP digest buffer (50 mM Tris-HCl, 5 ng/μL trypsin (sequencing grade, modified, Promega), 2 M urea ...
-
bioRxiv - Cancer Biology 2020Quote: ... the blot was blocked with either 5% nonfat-milk or 5% BSA in TBST before addition of primary antibodies and followed with peroxidase-conjugated secondary antibody (Promega). Protein bands were detected using SuperSignal Chemiluminescent Substrate (Pierce ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 and 6 d using a CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) (G3582; Promega, Madison, WI). Cells were incubated with the MTS reagent 3-4 h ...
-
bioRxiv - Neuroscience 2021Quote: ... Blots were washed 3 times in TBST for 5 minutes and were then incubated with HRP-conjugated secondary anti-mouse-IgG-H&L chain (Promega) or anti-rabbit-IgG-F(ab’)2 (GE Healthcare ...
-
bioRxiv - Plant Biology 2021Quote: ... Halo fusion proteins were produced from 1.5 µg plasmid DNA in a 15 µL reaction using TNT SP6 High-Yield Wheat Germ Protein Expression System (Promega). Protein expression was confirmed by Western blot with Anti-HaloTag monoclonal Ab (1:2000 ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were sonicated for 30 seconds before centrifugation and 5 μl of the supernatants were collected for luciferase expression reading by the dual-luciferase reporter assay system (Promega) using a GLOMAX 20/20 luminometer (Promega) ...
-
bioRxiv - Immunology 2021Quote: ... cells13 for 48 hours after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR mixture was at a volume of 10 μL containing 5 μL SYBR Premix Ex Taq (Promega, Madison, USA), 0.5 μM each of the primers ...
-
bioRxiv - Cell Biology 2021Quote: ... the antibody–bead mixture was resuspended in 500 μl of the reaction mixture containing 10 μg of fragmented total RNA,100 μl of reaction buffer and 5 μl of RNasin Plus RNase Inhibitor (Promega), and incubated for at least 4 h at 4 °C ...
-
bioRxiv - Biophysics 2020Quote: ... 1 mM EGTA, 5% glycerol) and freshly supplemented reagents (1 mM DTT, 1 mM ATP, 1 mM PMSF, protease inhibitor mix (Promega) and 1% Tween 20) ...
-
bioRxiv - Biophysics 2020Quote: ... Proteins were digested to peptides by addition of 25 μl of 50 mM ammonium bicarbonate containing 5 μg of trypsin (Promega) and incubating (37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The remaining iodoacetamide was quenched by adding 5 mM DTT and the proteins were digested with 150 ng trypsin (Trypsin Gold, Promega) for 90 min at room temperature in the dark ...
-
bioRxiv - Biochemistry 2022Quote: ... Remaining iodoacetamide was quenched by adding 5 mM DTT and the proteins were digested with 200 ng trypsin (Trypsin Gold, Promega) at 37 °C ON ...
-
bioRxiv - Neuroscience 2022Quote: DNA constructs with different WT and mutated 5’UTRs of mouse Sox2 mRNA were assembled in the psiCheck-2 vector (Promega) including synthetic Renilla luciferase gene (hRluc ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were diluted with ddH2O 1:5 and proteins were digested for 20 h at 37°C using trypsin (Trypsin Gold, Promega) at an enzyme/protein ratio of 1:50 ...
-
bioRxiv - Biochemistry 2022Quote: ... which had been pre-incubated in 200 μL Ex-Cell 420 medium plus 5 μL FuGENE HD transfection reagent (Promega) for 20 minutes at 27 °C ...
-
bioRxiv - Immunology 2022Quote: ... cells9 for 48 hours after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Immunology 2022Quote: ... for 48 h after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μg of the purified RNA was further treated in solution by 5 units of RQ1 DNase in 100 μl of 1x RQ1 buffer (Promega) for 1 h at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... 2ml of Sf9 cells at 0.5×106 cells per ml were transfected with 2 µg of fresh bacmid DNA and FuGene HD transfection reagent (Promega) at a ratio of 3:1 transfection reagent to DNA ...
-
bioRxiv - Immunology 2022Quote: The genomic DNA of the 5 assessed M strains were isolated and purified using the Wizard Genomic DNA Purification Kit (Promega). The growing of strains ...
-
bioRxiv - Neuroscience 2020Quote: ... Whole mount in situ hybridization was performed as previously described 55 with the following modifications: 5 dpf larvae were permeabilized by digesting with Proteinase K (10ug/ml, Promega) for 2 hours ...
-
bioRxiv - Microbiology 2020Quote: ... The plates were washed with PBS-T 5 times and a 1:5000 dilution of HRP-conjugated goat anti-rabbit IgG antibody (Promega) was added for 45 min at 37 □ ...
-
bioRxiv - Molecular Biology 2020Quote: ... and rehydrated with 5 μL of digestion solution containing 20 mM ammonium bicarbonate and 15 ng/μL sequencing grade trypsin (Promega). Digestion was carried out at 37°C for 6 h ...
-
bioRxiv - Cell Biology 2020Quote: ... and the proteins were on-bead digested using 5 µl of Sequencing Grade Trypsin (100 ng/µl in 10 mM HCl, Promega). The digestion was carried out at 37°C over night ...
-
bioRxiv - Microbiology 2021Quote: ... where the multiple cloning site had been replaced by a synthetic construct (Genewiz) composed of a 5’ HiBiT tag (Promega), a new multiple cloning site and 3’ 3xHA tag ...
-
bioRxiv - Cancer Biology 2021Quote: ... 293T cells were transfected with 8xTEAD synthetic YAP/TAZ-responsive promoter-luciferase reporter and treated with BSA or recombinant TNC (5 µg/mL) for 48 h to measure YAP1 signaling activity using Dual-luciferase Reporter Assay Kit (Promega).
-
bioRxiv - Immunology 2021Quote: ... Wells were then washed 5 times with wash buffer and the remaining bound cells were detected with the CellTiterGlo kit (Promega) as per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: Halo-MDC1 deletion mutants were expressed transiently by transfecting ∼ 5 × 105 cells with 1 µg of plasmid DNA using FuGene 6 (Promega). For genome editing ...
-
bioRxiv - Microbiology 2022Quote: ... was added to the plate and incubated at room temperature for 5 min before measuring luminescence on a GloMax 96 luminometer (Promega).
-
bioRxiv - Immunology 2022Quote: ... for 48 hours after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... between 0.5 to 1 µg of total RNA was reverse transcribed into cDNA using an ImProm II Reverse Transcriptase kit (Promega). Equal amounts of cDNA were quantified by RT-qPCR using the IQ SYBR green Supermix (Bio-Rad ...
-
bioRxiv - Genetics 2020Quote: ... double-stranded DNA oligos containing KRAB-ZFP target sequences (Supplemental Table 5) were cloned upstream of the SV40 promoter of the pGL3-Promoter vector (Promega) between the restriction sites for NheI and XhoI ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were grown in 5 mL LB medium overnight and plasmid DNA was isolated using the PureYield Plasmid Miniprep System (Promega). The plasmids were further tested by a restriction enzyme digestion analysis ...
-
bioRxiv - Immunology 2021Quote: ... The mixture was subsequently incubated with 293TAce2 cells for 48 h after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Plant Biology 2021Quote: ... For SlTPD1 a 284 bp DNA fragment from the 5’ coding region was amplified by PCR using cDNA from flowers and cloned into the pGEM-T Easy vector (Promega). For TomA5B and SlSDS genes ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was isolated from approximately 5×105 cells using the ReliaPrepTM RNA Cell Miniprep System (Promega, UK, Cat. Z6012) following product guidelines ...
-
bioRxiv - Molecular Biology 2021Quote: A total of 10 μg of bacmid DNA was transfected into 6 wells of 2×106 adherent Sf9 cells (at 5×105 cells/ml) using the transfection reagent Fugene HD (Promega). 42–72 h post transfection ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were harvested day 1 and day 5 post-infection using a CellTiter-Glo Luminescent Cell Viability Assay Kit (Promega) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... At 48 h later the cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Immunology 2021Quote: ... extensively washed to remove unbound virus and co-cultured with Huh7.5 for 5 days at 37°C after which they were analyzed for with the Luciferase assay system (Promega, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Huh7.5.1 cells were infected with MLB1 and MLB2 astroviruses (MOI 5) in the presence or absence of 20 µM z-VAD-fmk (pan-caspase inhibitor, Promega). At indicated time post infection ...
-
bioRxiv - Developmental Biology 2022Quote: ... Proteins were on-bead digested using 5 μl of Sequencing Grade Trypsin (100 ng/μl in 10 mM HCl, Promega). The digestion was carried out in a microwave instrument (Discover System ...
-
bioRxiv - Molecular Biology 2022Quote: ... from the EPO gene enhancer (sequence: tcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgttcgaagccctacgtgctgtctcacacagccttct gatctcgacctaccggccgttcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgt) into the 5’ of the minimal TATA-box promoter in the pGL4.23 [luc2/minP] vector (Promega #E841A). A control pHRL-TK vector (Promega #E2241 ...