Labshake search
Citations for Promega :
1501 - 1550 of 8253 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... Cell Titer Glo (Promega G7573) was used to quantify survival 4 days post-transduction ...
-
bioRxiv - Genomics 2024Quote: ... Cell Titer Glo (Promega G7573) was used to quantify survival after 48 hours of Puromycin selection ...
-
bioRxiv - Biochemistry 2024Quote: ... coli cells (Promega, Madison, WI) and selected on LB agar with 50 µg/ml spectinomycin ...
-
bioRxiv - Cancer Biology 2023Quote: ... or Cell-Titer Glo (Promega) was used to determine the cell number under various treatments ...
-
bioRxiv - Biochemistry 2023Quote: ... coli KRX competent cells (Promega), cultured in LB at 37°C and protein expression was induced with 0.1 mM IPTG and 0.05% rhamnose overnight at 18°C ...
-
bioRxiv - Biochemistry 2023Quote: ... coli KRX competent cells (Promega), cultured in LB at 37°C and protein expression was induced with 0.1 mM IPTG and 0.05% rhamnose overnight at 18°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell-titer Glo (Promega, G7570) was used to investigate cell viability ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell Titer Glo reagent (Promega) was equilibrated to room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli cells (Promega, USA, Madison) as per manufacturer’s instructions and grown overnight on ampicillin agar plates at 37 °C for 14 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... whereupon Cell Titer Glo (Promega) was added to each assay well in individual plates through automated liquid dispensing ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cell Titer Glo 2.0 (Promega) was used as instructed at the time points indicated in the manuscript ...
-
bioRxiv - Biochemistry 2024Quote: ... coli JM109 competent cells (Promega) and the resulting colonies were cultured and mini-prepped (QIAGEN) ...
-
bioRxiv - Genomics 2021Quote: ... DNA was quantified using both the Qubit dsDNA HS Assay Kit on the Qubit 3.0 Fluorometer and the Plexor HY DNA Quantification Kit (Promega Corporation, Madison, WI) prior to submission for microarray genotyping.
-
bioRxiv - Biochemistry 2023Quote: The NAD/NADH-Glo™ Assay kit (#G9071, LOT: 0000469987) and the NADP/NADPH- Glo™ Assay kit (#G9081, LOT: 0000472344) were purchased from Promega. Vacor (Pyrinuron N- 13738 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were authenticated using genomic DNA extracted with Puregene Gentra Kit and multiplexed using the Promega Geneprint Kit and multiplexed with a STR-based method (Promega Geneprint System). Samples were run on an Applied Biosystems 3130xl DNA analyser and the results analysed using the Applied Biosystems Genemapper v4.1 software ...
-
bioRxiv - Biochemistry 2023Quote: ... The P450-Glo CYP1A1/1B1 assay kit and NADPH regeneration system and luciferase assay kit were purchased from Promega (Promega, Madison, WI) and utilized under the following conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was extracted from FFPE blocks using either the Qiagen AllPrep® DNA/RNA FFPE kit for FFPE-derived samples or using the Maxwell® RSC FFPE Plus DNA Kit (Promega). For frozen blocks ...
-
bioRxiv - Molecular Biology 2023Quote: ... the RNA/Protein Purification Plus kit (Norgen, Thorold, ON, Canada) or the Maxwell 16 LEV simplyRNA purification kit (Promega, Madison, WI, USA) according to the manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... BXPC-3 and CAPAN-1 pancreatic cancer cells treated with UR214-9 was measured using the Cell Titre96R Aqueous One Solution Cell Proliferation Assay (Promega Corp., catalog number: G3580) following the procedure published earlier ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized with the ImProm II Kit (Promega). qPCR was performed using the Brilliant III Ultra-Fast SYBR® Green QPCR Master mix reagents (Agilent Technologies ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized with a reverse-transcriptase kit (Promega). RNA of cells exposed to SARS-CoV-2 WT was isolated with the QIAamp Viral RNA Mini Kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... luciferase signal was quantified using the DualGlo kit (Promega). Each experiment was performed in triplicate with two biological replicates ...
-
bioRxiv - Molecular Biology 2020Quote: ... was subjected to poly(A)+tract isolation kit (Promega). Poly(A)+ enriched RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... According to the instructions of the detection kit (Promega), the cells were transfected with the luciferase reporter gene level plasmid ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized using the Reverse Transcription kit (Promega). Transcriptional levels of IFN-β ...
-
bioRxiv - Biochemistry 2020Quote: ... The pGEM-T Vector kit was purchased from Promega. Acrylamide/bisacrylamide (29:1 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... using the Wizard® Genomic DNA Purification Kit (Promega). The kit can be used for at least 100 isolations ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using the Maxwell 16 LEV Plant DNA Kit (Promega), with EcoR1 as the restriction enzyme for generating RAD-seq libraries ...
-
bioRxiv - Cell Biology 2020Quote: ... Luciferase activity was measured by luciferase assay kit (Promega) using an LMaxII™ microplate luminometer (Molecular Devices) ...
-
bioRxiv - Cancer Biology 2021Quote: FGFR1 kinase enzyme system kit was purchased from Promega Inc ...
-
bioRxiv - Cell Biology 2021Quote: ... we used the CellTiter-Glo® Luminescent kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Neutralization was measured with a luciferase assay kit (Promega) and plotted relative to the value for control wells.
-
bioRxiv - Plant Biology 2020Quote: ... or Maxwell® 16 LEV Plant RNA Kit (Promega). cDNA was synthesized using Primescript II 1st Strand cDNA Synthesis Kit (Takara ...
-
bioRxiv - Plant Biology 2021Quote: ... using the Maxwell 16 LEV Plant RNA Kit (Promega). RNA was quantified using a NanoDrop (Thermo Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using MMLV reverse transcriptase kit (Promega) according to the manufacturers’ protocol with random primers (Promega) ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was extracted using the Wizard Kit (Promega), as stated above ...
-
bioRxiv - Microbiology 2021Quote: ... The Wizard genomic DNA purification kit (Promega, Madison, WI) was used for isolation of bacterial genomic DNA (gDNA) ...
-
bioRxiv - Cell Biology 2020Quote: A GenePrint 10 System PCR Amplification kit (Promega Corporation) was used to determine the genetic signature of both samples based on the multiplex analysis of 9 loci and the Amelogenin sex-determining marker ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA synthesised (AMV Reverse Transcriptase kit, Promega, Southampton, UK) and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC ...
-
bioRxiv - Microbiology 2022Quote: ... with the Maxwell® RSC Blood DNA kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized using the reverse transcription kit (Promega) and transcriptional expression of IFIT1 (Fw ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA synthesis was done with reverse transcription kit (Promega) using 50ng of total RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the Maxwell DNA LEV Blood Kit (Promega #AS1290) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... purified using a Wizard Genomic DNA Purification kit (Promega), and sent for Sanger sequencing (ACGT) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Triglyceride-Glo™ Assay kit (Cat#J3160, Promega) from Promega were used according to user’s manual ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and purified with the Wizard SV Gel kit (Promega). The purified DNA was incubated with DpnI (New England BioLabs® ...
-
bioRxiv - Genetics 2021Quote: ... using the Maxwell 16 Tissue DNA Purification kit (Promega). The ddRAD-seq library was constructed using all the genomic DNAs according to the method described in Peterson et al ...
-
bioRxiv - Plant Biology 2020Quote: ... The GoTaq qPCR Master Mix Kit (Promega Corporation, USA) was used for the gene expression profiling ...
-
bioRxiv - Microbiology 2021Quote: ... In vitro transcription reactions (Promega MegaScript T7 transcription kit) containing ∼400 ng of the purified PCR product ...
-
bioRxiv - Microbiology 2021Quote: ... we used the CellTiter-Glo® Luminescent kit (Promega), following the manufacturer’s instructions ...