Labshake search
Citations for Promega :
1451 - 1500 of 4156 citations for 6 7 Dihydro 2 formyl 5H pyrrolo 1 2 a imidazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... Cells were transiently transfected with 0.4 µg DNA using FuGENE 6 transfection reagent (Promega) in a 1:3 µg DNA:µL FuGENE ratio 48 h before electrophysiology measurements were performed.
-
bioRxiv - Immunology 2020Quote: ... China) or the D614G variant (constructed by site-directed mutagenesis) using FuGENE 6 (Promega). The next day ...
-
bioRxiv - Developmental Biology 2020Quote: ... For the immunolabeling experiment HeLa cells were transfected with plasmids using FuGENE 6 (Promega). For streptavidin pull-down assays from HEK293T cells ...
-
bioRxiv - Genetics 2021Quote: ... Plasmid transfection of U2OS cells was carried out using FuGENE 6 Transfection Reagent (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... Transfection with plasmid was performed following standard protocols for Fu gene 6 (Promega, #E2691). Cells were selected for stable expression using Geneticin (G418 sulfate ...
-
bioRxiv - Biophysics 2021Quote: ... U2OS cells transfection with engineered lentiCRISPRv2 were done using FuGENE 6 transfection reagent (Promega). Positive clones were selected using puromycin and subsequently isolated.
-
bioRxiv - Cell Biology 2022Quote: ... Bacmids were transfected to Sf9 insect cells by lipofection (FuGENE 6 Transfection Reagent, Promega), to generate baculovirus ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 ng/μl of mRNA and 6 ng/μl QuantiLum Recombinant Luciferase protein (Promega) were coinjected ...
-
bioRxiv - Biochemistry 2024Quote: ... 24 hours after transient transfection with mouse or human ENPP3 via Fugene 6 (Promega), the media was gently removed and replaced with serum-free DMEM supplemented with 1% insulin-transferrin-selenium-sodium pyruvate (ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with TPMT-FLAG or TPMT A80P-FLAG with FuGENE 6 (Promega). 24 h post transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid transfection of U2OS cells was carried out using FuGENE 6 Transfection Reagent (Promega) according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2023Quote: ... Plates were collected at day 6 and measured by CellTiter-Glo (Promega #PR-G7573). Cell viability values were analyzed following blank cell deductions and normalization to vehicle readings ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transfected with MX2-mScarlet vector using FuGENE 6 transfection reagent (#E2691, Promega) following the manufacturers protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... + 0.2 μg pMAX-GFP + 7.8 μL Fugene 6 (for LLP lines, Promega cat#E2691) or Fugene HD (for RPLP lines ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: Cell death by apoptosis was measured using Caspase-Glo 3/7 luminescent assay system kit according to the manufacturer’s instructions (Promega Madison, WI). Briefly ...
-
bioRxiv - Microbiology 2022Quote: Activity of caspases-3/7 and -8 were assessed using the corresponding Caspase-Glo® Assays in white-walled 96-well plates (Promega).
-
bioRxiv - Cell Biology 2023Quote: The activity of the proteasome’s β5 sites was determined either by Succinyl(Suc)-LLVY-AMC (7-amido-4-methylcoumarin) fluorogenic substrate or by the Proteasome-Glo™ assay (Promega), a luciferase coupled assay ...
-
bioRxiv - Cancer Biology 2024Quote: The apoptotic effect of MK-1775 was determined by means of caspase 3/7 activity via Apotox-Glo Triplex Assay (Promega, #G6320) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were processed at different times post inoculation (pi) according to manufacturer’s instructions (Caspase-Glo® 3/7 Assay kit, Promega, USA) to determine caspase 3/7 activity ...
-
bioRxiv - Neuroscience 2019Quote: ... Plasmid transfections were carried out with Fugene® 6 Transfection Reagent (Promega, Madison, WI, USA) with the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2019Quote: ... cells were transfected with a transfection cocktail of 0.6 μl of Fugene 6 (E2693, Promega), with 20 μl Opti-MEM (11058-021 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were grown on coverslips or in dishes and transfected using FuGENE® 6 (Promega).
-
bioRxiv - Microbiology 2021Quote: ... In vitro transfections were performed with FuGENE®6 Transfection Reagent (Promega, cat. no E2691) as described previously (Hong et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... the cells were transfected 16 h after plating using FuGENE® 6 Transfection Reagent (Promega). For PLD2 inhibition ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transfected with plasmid DNA using FuGENE 6 according to the manufacturer’s instructions (Promega). Cells were fixed with 4% formaldehyde in PBS and permeabilised in 0.5% (v/v ...
-
bioRxiv - Immunology 2021Quote: ... B.1.351) with TMPRSS2 into 293T cells using Fugene 6 transfection reagent (Promega, Madison, WI)54–56 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: HEK-293 cells transiently transfected with PAR2-YFP or mutant PAR2-YFP (Fugene 6, Promega) were sub-cultured onto 35-mm glass-bottom culture dishes (MatTek Corporation ...
-
bioRxiv - Cell Biology 2019Quote: ... Sub-confluent Hela cells were transfected with 1µg of px459 vector using FuGENE 6 (Promega). Transfected cells were selected with 2 µg/ml puromycin for 2 days and surviving cells were subsequently plated in 96 well plates at 1cell/well density to generate clonal lines ...
-
bioRxiv - Cancer Biology 2021Quote: ... shRNA constructs were packaged in HEK 293T cells using FuGENE 6 Transfection Reagent (Promega E2691) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... Transient transfection with plasmids was performed using standard manufacturer protocols with Fugene 6 (Promega, #E2691).
-
bioRxiv - Immunology 2022Quote: ... and luciferase were co-transfected in HEK293T cells using the FuGENE 6 Transfection Reagent (Promega) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell viability was assayed 6 d after compound addition with the CellTiter-Glo reagent (Promega). Luminescence well values were normalized to DMSO-treated wells by subtracting per-plate average DMSO log2-luminescence values from the log2-luminescence values of each treatment well.
-
bioRxiv - Molecular Biology 2022Quote: ... and 6-day-old larval guts was extracted using an RNA extraction kit (Promega, USA) and then equally divided into two portions ...
-
bioRxiv - Molecular Biology 2022Quote: ... were transfected with 0.5 μg AsCpf1 or SpCas9 plasmid using Fugene 6 transfection reagent (Promega) according to manufacturer’s guideline ...
-
bioRxiv - Cancer Biology 2023Quote: ... All transfections were performed using Fugene-6 transfection reagent according manufacturers protocol (Promega, cat E2691).
-
bioRxiv - Biochemistry 2023Quote: ... Transfections of the PX459 constructs were performed individually using FuGENE 6 Transfection Reagent (Promega E2691) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2023Quote: ... in the presence or absence of indicated expression vectors using FuGene 6 transfection reagent (Promega). 36 hours after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... ND7/23 cells were transfected with FuGENE® 6 Transfection Reagent (Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... The vector was transfected into Flp-In™ 293 cells using Fugene 6 (Promega, E269A) and 24 hours later the cells expressing the fluorescent reporter were sorted in a 96 well plate as single cells using the Sony SH800 cell sorter ...
-
bioRxiv - Cancer Biology 2022Quote: Apoptosis induction in response to SRRM1 silencing in leukemia cell lines (25,000 cells/well onto white-walled multiwell luminometer plates) was performed by using Caspase-Glo® 3/7 Assay (Promega Corporation, #G8091) as previously reported (67) ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were collected 24 hours after transfection and mixed with equal volume of Nano-Glo® Luciferase Assay reagent and the relative luminescence (RLU) was measured after 7 minutes using GloMax® 20/20 Luminometer (Promega). The identical cell lysate was then used for protein concentration determination using Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... and viability of the spheroids was determined after 7 days of treatment with the CellTiter-Glo® 3D Cell Viability Assay (Promega G9682) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... SEA (0.2 mg/ml) and soluble schistosomula antigens (0.2 mg/ml) was determined using the Caspase-Glo® 3/7 Assay System (Promega, Sydney, Australia) according to the manufacturers’ instructions.
-
bioRxiv - Plant Biology 2024Quote: ... 4 µl of the RNA from input and supernatant and 7 µl of the pre-eluates and eluates were digested with RQ1 DNase I (Promega, Walldorf, Germany) and cDNA synthesis was carried out with Superscript IV reverse transcriptase (Thermo Fischer ...