Labshake search
Citations for Promega :
1451 - 1500 of 2934 citations for 1 1' Diethyl 4 4' bipyridinium dibromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Samples were further digested overnight with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR reactions using the GoTaq 1-Step RT-qPCR kit (Promega) were set-up to 10 µl final reaction volumes according to the manufacturer’s instructions containing 250 nM of each receptors primer pairs and 10 ng of RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Histones were then digested with 1 µg of sequencing grade trypsin (Promega) diluted in 50mM ammonium bicarbonate (1:20 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5 µL 1:25 diluted Nano-Glo luciferase assay substrate (Promega, N113A) in PBS was dispensed into each well and quickly mixed ...
-
bioRxiv - Neuroscience 2024Quote: ... Reverse transcription was performed with 1 μg RNA using reverse transcriptase (Promega) and random hexamers for cDNA synthesis ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 mM DTT) optimized for TEV protease cleavage (ProTEV Plus, Promega, V6101). Samples were adjusted to a final volume of 10 mL with 100U TEV protease and incubated at 4°C for overnight ...
-
bioRxiv - Pathology 2024Quote: ... horseradish peroxidase-conjugated anti-rabbit IgG (1:5000, W4011; Promega, Tokyo, Japan) was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... secondary antibodies: anti-rabbit HRP or anti-mouse HRP (Promega, 1:10000).
-
bioRxiv - Developmental Biology 2024Quote: ... and 1:10000 of the HRP-conjugated Anti-Rabbit IgG (Promega W401B) and Anti-Mouse IgG (Promega W402B) ...
-
bioRxiv - Neuroscience 2024Quote: ... The HaloTag-fused proteins were subsequently labeled with 1 µM TMR (Promega) in medium for 15 min at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Histones were then digested with 1 µg of sequencing grade trypsin (Promega) diluted in 50mM ammonium bicarbonate (1:20 ...
-
bioRxiv - Microbiology 2024Quote: ... incubated with a 1:8000 dilution of anti-rabbit HRP (Promega W4011) for 1 hr ...
-
bioRxiv - Biochemistry 2024Quote: ... proteins were digested with 1 µg premixed trypsin/endoproteinase Lys-C (Promega) at 37 °C for 16 h with shaking at 800 rpm ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg trypsin/Lys-C Mix (CAT# V5072; Promega, Madison, WI, USA) was gently mixed with the sample for 14 h at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 mM CaCl2 and sequencing-grade modified porcine trypsin (Promega, Madison, WI) was added to all protein samples at a 1:50 (w/w ...
-
bioRxiv - Developmental Biology 2024Quote: ... PVDF membranes were subsequently incubated with Streptavidin Alkaline Phosphatase (1:5000; Promega) to visualize proteins in Transcend Chemiluminescence Substrate (Promega) ...
-
bioRxiv - Cell Biology 2024Quote: ... or anti-rabbit IgG HRP Conjugate (1:10000, Promega, Cat no. W4011) in blocking buffer and developed using the SuperSignal West Femto Maximum Sensitivity Substrate kit (Thermofisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 U/μL RNasin Plus RNase inhibitor (Promega, Madison, WI, USA) for 1 h at 30°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% of an equal molar mix of unmethylated lambda DNA (Promega, D1521) and fully methylated T7 was spiked into genomic DNA ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were digested overnight with 1:100 sequencing grade trypsin (V5113; Promega), followed by quantification of the generated peptide pools using a Nanodrop (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... Digestion was stopped by adding 1 µl of RNasIn Plus (Promega #N2611) and chilling on ice for 5 mins.
-
bioRxiv - Biochemistry 2024Quote: ... Histones were then digested with 1 µg of sequencing grade trypsin (Promega) (1:20 ...
-
bioRxiv - Biochemistry 2024Quote: ... 8 μL of 1/10 diluted Nano-Glo® substrate (Promega N1130) and either 10 μM effector and 200 μM partner or just 200 μM partner was added to these wells using a multichannel pipette ...
-
bioRxiv - Genetics 2024Quote: ... and 1 mM DTT in 1x Reaction Buffer A (K03-09, Promega) to a total volume of 25 μl for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... The RNA (1 µg) was treated with RQ1 RNase-free DNase (Promega, WI) and then reverse-transcribed using High-Capacity cDNA RT kit (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... cells were washed 1 × with PBS and lysed with Cell Lysis Buffer (Promega) at RT for 20min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were then lysed in 100 μl of 1× Passive Lysis Buffer (Promega) and luciferase activity in 10 μl aliquots of the cell lysates was measured using the Dual Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Cell Biology 2022Quote: RPE-1 GFP-Sec61β stable cell line was generated by Fugene-HD (Promega) transfection of pAc-GFPC1-Sec61β ...
-
bioRxiv - Neuroscience 2021Quote: ... Further overnight digestion was carried out with 1:20 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 ng/well pGL4.74 plasmid (Luc2P/hRluc/TK, control luciferase reporter plasmid, Promega), and 100 ng/well of SMAD2/3 responsive reporter plasmid pGL4.48 (luc2P/SBE ...
-
bioRxiv - Molecular Biology 2021Quote: ... An anti-mouse IgG-horseradish peroxidase (HRP) conjugate (1:4000 Promega, Fitchburg, USA) was used as secondary antibody ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were washed with PBS and lysed with 1× passive lysis buffer (Promega). The Dual-Luciferase Reporter Assay System and GLOMAX (both Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were washed with PBS and lysed with 1× passive lysis buffer (Promega). Luciferase assay reagent and GLOMAX (both Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... primers (Supplementary Table 1) and GoTaq® G2 Flexi DNA polymerase (M7801, Promega). Resulting PCR products were purified on columns (Isolate II PCR Kit (BIO-52059 ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were digested overnight at 37 °C with 1 μg of trypsin (Promega). Subsequently ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... approximately 5.2 µg of purified gDNA (spiked with 1% unmethylated lambda DNA, Promega) was sheared into fragment size of 200-300 bp using Covaris S220 ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were digested overnight at 37°C with 1 µg of LysC (Promega) 38 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μg RNA was reverse transcribed using GoScript Reverse Transcription Mix (A2790, Promega,) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... 1:3,000 dilution of HRP-conjugated anti-mouse IgG secondary antibody (W402B, Promega) was added and incubated for one additional hour ...
-
bioRxiv - Immunology 2020Quote: ... The medium was supplemented with 1 mM beetle luciferin potassium salt solution (Promega) and bioluminescence assayed at room temperature using Varioskan Flash (Thermo Fischer).
-
bioRxiv - Cancer Biology 2020Quote: ... in a ratio of 100:1 using ViaFect transfection reagent (Promega Cat# E4982). Seven TCF/LEF-binding sites are present upstream of a firefly luciferase gene in the TOPflash vector ...
-
bioRxiv - Bioengineering 2021Quote: ... + 10% FBS containing 1% v/v of cAMP GloSensor substrate stock solution (Promega). The cells were incubated in substrate-containing medium at 37 °C in 5% CO2 for at least 2 h (maximally 8 h) ...
-
bioRxiv - Microbiology 2021Quote: ... cells were resuspended in lysis buffer (1 x FastBreak cell lysis reagent (Promega), 50 μg/mL lysozyme ...
-
bioRxiv - Plant Biology 2020Quote: ... Next 1 µg of total RNA was circularized with T4 RNA ligase (Promega), desalted with Amicon Ultra 0.5ml (10K ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μL of AAV solution was treated with RQ1 DNase (Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: Kidney pieces (1/3 of kidney) were homogenized in Passive Lysis Buffer (Promega) containing protease inhibitors (Thermofisher) ...
-
bioRxiv - Neuroscience 2020Quote: Inflammasome activity was measured using Caspase-Glo® 1 Inflammasome Assay (G9951; Promega). iPS-Mg were plated at 50,000 cells/well in opaque 96-well plates and treated O/N with PS+ cells ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Cell Biology 2021Quote: ... RPE-1 cells were transfected with pX458 using Fugene HD transfection reagent (Promega) according to the manufacturer’s protocol and 48 hours later cells were selected for 3 weeks with 10 mM Nutlin-3 (Selleck Chemicals) ...
-
bioRxiv - Microbiology 2021Quote: ... Immunodetection was carried out using rabbit polyclonal anti-Halo antibody (Promega; 1:1000), mouse anti-HA antibody (Roche ...