Labshake search
Citations for Promega :
101 - 150 of 2737 citations for TREM 1 Human HEK 293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: Commercial human DNA (Promega, Cat. No. G1521) was used for PCR amplification of all tested genome fragments from AF associated loci (for primers used see Supplementary Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... These included 5μg/ml human gDNA (Promega), 500ng/ml citrullinated histones (Cayman Chemical #501620) ...
-
bioRxiv - Microbiology 2023Quote: ... Human gDNA (Promega, San Luis Obispo, CA) was added to the extracted gDNA from the clinical swabs to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2024Quote: ... a K562 human peptide digest standard (Promega) and E.coli peptide standard (Waters ...
-
bioRxiv - Genomics 2023Quote: ... Human male genomic DNA (Promega, CAT #G1471) was used for a standard curve at 125 pg/µL ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pEGFP-C1-human Rab29 was generated by inserting human Rab29 sequence from pFN21A-Halo-Rab29 (Promega, #FHC08084) into Bgl II - Eco RI site of pEGFP-C1-rat Rab29 plasmid that was used previously11 ...
-
bioRxiv - Developmental Biology 2020Quote: His-P150-CC1 (Courtois et al., 2012) was expressed in and purified from BL21(DE3)pLysS competent cells (Promega) as previously described (Courtois et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Restricted fragments to be cloned were ligated into the EcoRI and SacI restricted pBAD/His using T4 Ligase (Promega) before being heat shock-transformed into chemically competent E ...
-
bioRxiv - Biochemistry 2023Quote: ... Rat Gβ1 was fused with a His-tag at the N terminus and with a SmBiT subunit (peptide 86, Promega)34 after a 15-amino acid linker at its C terminus ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... bulked to 200ng using human genomic DNA (Promega). All samples were sheared for 150 seconds using a Covaris E220 (Duty Factor 5% ...
-
bioRxiv - Systems Biology 2020Quote: The Human cell lysate was obtained commercially (Promega) and the yeast digest was prepared as previously described23 ...
-
bioRxiv - Genomics 2019Quote: ... We added 4μl pooled commercial human gDNA (Promega) to all samples to ensure total gDNA > 1μg/35μl ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... Human GSK-3β was purchased from Promega (V1991).
-
bioRxiv - Genomics 2020Quote: ... and human gDNA (Promega, San Luis Obispo, CA) was added to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2021Quote: ... and SETD2 human ORF were procured from Promega. Deletion mutants of hnRNP L ...
-
bioRxiv - Biochemistry 2022Quote: Human cancer cell line digest standards K562 (Promega) and diluted to 100 microgram/mL in 50mM TEAB and labeled with TMTPro reagents according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and human Renilla luciferase (pGL4.74[hRluc/TK], Promega, E6921) were used in the study ...
-
bioRxiv - Microbiology 2020Quote: ... insert (NRP1, native human ORF in pF1K, FXC23812, Promega): 5’-atagggcgaattcggtagtaaggagcgatcgc-3’ (fwd ...
-
bioRxiv - Cancer Biology 2022Quote: ... were amplified by PCR from human genomic DNA (Promega), using the primers listed in Table S1 and then inserted into the psiCHECK-2 vector ...
-
bioRxiv - Biochemistry 2022Quote: ... human GR and MR were cloned into pACT (Promega) as N-terminal VP16 fusions using HiFi assembly (NEB) ...
-
bioRxiv - Cell Biology 2019Quote: ... A cDNA encoding human KIF1A was purchased from Promega Japan (Promega Japan ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Human PAR2 with N-terminal nano-luciferase (nLuc, Promega) and C-terminal enhanced Yellow Fluorescent Protein (eYFP ...
-
bioRxiv - Molecular Biology 2021Quote: ... or goat anti-Human IgG (H+L) (Promega, W4031) antibodies were added for 30 min at room temperature ...
-
bioRxiv - Microbiology 2023Quote: 1 ml of recombinant His-MBP-AlpA and His-MBP at a concentration of 10 μM was incubated with 100 μl MagneHis™ Ni Particles (Promega) equilibrated with pulldown-buffer (50 mM Tris pH 7.5 ...
-
bioRxiv - Molecular Biology 2021Quote: The CD19 minigene was amplified from human genomic DNA (Promega) with the primers 5’-catAAGCTTgaccaccgccttcctctctg-3’ and 5’-catGAATTCNNNNNNNNNNNNNNNGGATCCttcccggcatctccccagtc-3’ ...
-
bioRxiv - Neuroscience 2020Quote: ... the human CB1R was cloned into the pCI vector (Promega), and eCB2.0 and eCBmut were cloned into the peGFP-C1 vector (Takara) ...
-
bioRxiv - Immunology 2022Quote: ... and a β-globin calibration curve (human genomic DNA [Promega]) was concurrently evaluated on each plate ...
-
bioRxiv - Microbiology 2020Quote: ... The human codon-optimized NanoLuc Luciferase reporter gene (Nluc, Promega) was inserted in place of nucleotides 1-100 of the nef-gene ...
-
bioRxiv - Genomics 2022Quote: ... 10 ng/mL recombinant human basic fibroblast growth factor (Promega), and 1 μM dexamethasone (Sigma-Aldrich) ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... donovani BPK282/0 cl4 promastigote DNA with human DNA (Promega) from 1/15 to 1/150000 (Leishmania:human ...
-
bioRxiv - Biochemistry 2020Quote: hnRNP L and SETD2 human ORF were procured from Promega. Deletion mutants of hnRNP L and SETD2 were constructed by PCR (Phusion polymerase ...
-
bioRxiv - Immunology 2020Quote: ... The human codon-optimized nanoluc Luciferase reporter gene (Nluc, Promega) was inserted in place of nucleotides 1-100 of the nef-gene ...
-
bioRxiv - Molecular Biology 2022Quote: ... Serial dilutions of genomic DNA from human placenta (G1471, Promega) were used as a standard for quantification and their concentration.
-
bioRxiv - Microbiology 2022Quote: ... falciparum 3D7 DNA with commercially available human DNA (Promega, G304A) to a total amount of 400ng DNA ...
-
bioRxiv - Neuroscience 2024Quote: Human male genomic DNA obtained from Promega (Ref:G1471; Madison, WI) was used to generate the input library ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... 24h prior to imaging cells were co-transfected with human PEX31-42-GFP-Halo and either human HAP1-mCherry-eDHFR or mouse BICD21-572-mCherry-eDHFR using FuGENE 6 (Promega; 1 µg total DNA) and 48h prior to imaging with control siRNA using Lipofectamine RNAiMAX (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2020Quote: ... pT7-IRES His-T7-HCF-1VIC was in vitro transcribed/translated using the TnT Quick Coupled Transcription/Translation System (Promega, Madison, Wisconsin, L1171). Two milligrams recombinant MYC and 12 μl T7-HCF-1VIC were rotated overnight at 4°C in Kischkel buffer + PIC (Roche 05056489001) ...
-
bioRxiv - Microbiology 2021Quote: ... The linearized vector and the slpMh-6x His fragment were gel-purified using the Wizard® SV Gel and PCR Clean-Up System (Promega, Mannheim, Germany) and assembled via isothermal in vitro ligation according to Gibson et al ...
-
bioRxiv - Molecular Biology 2020Quote: ... and pooled human male DNA (G3041, Promega and 4312660, Life Technologies) were used to generate calibration curves and serve as reaction controls ...
-
bioRxiv - Biochemistry 2020Quote: SETD2-HaloTag® human ORF in pFN21A was procured from Promega. Deletion mutants of SETD2 were constructed by PCR (Phusion polymerase ...
-
bioRxiv - Biochemistry 2020Quote: SETD2-HaloTag® human ORF in pFN21A was procured from Promega. Deletion mutants of SETD2 were constructed by PCR (Phusion polymerase ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human 26S proteasome purified from HEK293 cells was purchased from Promega. The proteasome chaperoning reaction tests were carried out as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... Human normal genomic DNA was obtained from Promega (Madison, WI, USA) and the values are averages of three replicates ...