Labshake search
Citations for Promega :
101 - 150 of 1145 citations for Recombinant Human Aldehyde Dehydrogenase 3 Family MemberA1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... All conditions used were tested for cytotoxicity by measuring lactate dehydrogenase in the conditioned media after 24 h incubation according to the manufacturer’s instructions (CytoTox96, Promega) (Figure S1).
-
bioRxiv - Cell Biology 2023Quote: ... lactate dehydrogenase (LDH) release assay was performed using CytoTox 96 Non-Radioactive Cytotoxicity Assay kit (Promega, Madison, Wisconsin, USA) according to manufacturer’s instruction ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2019Quote: ... the His-VqmA was purified using MagneHis Ni-Particles (Promega).
-
bioRxiv - Cell Biology 2024Quote: ... HIS-PLK1 used in ADP-Glo was from Promega (V2841). HIS-PLK1 used in Fig ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... HiBit-tagged proteins were detected using the NanoGlo HiBit Blotting kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... recombinant Trypsin was purchased from Promega (WI. USA), Indium-tin-oxide (ITO ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 30 μL Recombinant RNasin Ribonuclease Inhibitor (Promega). Ten milligrams of protein was incubated with 4 μL α-myc antibody (Sigma M4439 ...
-
bioRxiv - Immunology 2021Quote: ... in the presence of recombinant RNase inhibitor (Promega) and concentration was determined (Nanodrop 2000 spectrometer ...
-
bioRxiv - Biochemistry 2023Quote: OuantiLum® Recombinant Luciferase was purchased from Promega. Creatin Kinase from rabbit muscle was purchased from Sigma Aldrich.
-
bioRxiv - Biophysics 2023Quote: ... we added 1.5µL of recombinant RNAsin (Promega N2515) and 6µL of nuclease-free water (Promega P1193 ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 U/μl Recombinant RNasin Ribonuclease Inhibitor (Promega), 45 mM sodium chloride ...
-
bioRxiv - Plant Biology 2024Quote: ... 10μl Recombinant RNasein© Ribonuclease inhibitor (N2515; Promega) was added to inhibit RNaseA activity and samples were flash frozen in liquid nitrogen until analyzed ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNase inhibitor (Recombinant RNasin 20 U/ml; Promega) and 0.15 % Tween-20 ...
-
bioRxiv - Microbiology 2020Quote: ... Cell viability was assessed by measuring the lactate dehydrogenase released in the supernatant with CytoTox 96 Non-Radioactive Cytotoxicity Assay (Promega) following manufacturer’s instruction.
-
bioRxiv - Cancer Biology 2020Quote: ... Cytotoxicity was analyzed by measuring levels of released lactate dehydrogenase (LDH) using the CytoTox 96 non-radioactive cytotoxicity assay protocol (Promega).
-
bioRxiv - Immunology 2021Quote: Lactate dehydrogenase release in the BAL of IAV-infected mice was quantified using the CytoTox 96 Non-Radioactive Cytotoxicity Assay (Promega), per the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... Cell death was determined according to the activity of lactate dehydrogenase (LDH) in the culture supernatants using a CytoTox1 Kit according to the manufacturer’s instructions (Promega, USA).
-
bioRxiv - Bioengineering 2020Quote: ... The cell lysis in each well was quantified by measuring the lactate dehydrogenase (LDH) released into the media using a nonradioactive cytotoxicity assay (CytoTox 96 Non-Radioactive Cytotoxicity Assay, Promega) following the manufacturer’s manual.
-
bioRxiv - Neuroscience 2020Quote: ... Cell viability was also determined based on lactate dehydrogenase (LDH) activity in conditioned culture media using a commercial kit (G1780, Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... cytotoxicity of Bordetella infection was measured as lactate dehydrogenase (LDH) release into cell culture media using CytoTox 96 assay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... towards HeLa cells was determined as a release of the intracellular enzyme lactate dehydrogenase (LDH) into the cell culture media using CytoTox 96 assay (cat.no. G1780, Promega, USA) or as changes in cell membrane integrity using CellTox Green Cytotoxicity Assay (cat.no ...
-
bioRxiv - Microbiology 2020Quote: ... All drugs were dissolved in dimethyl sulfoxide (DMSO) and their cytotoxicity determined using a lactate dehydrogenase (LDH) assay (Promega, UK).
-
bioRxiv - Pathology 2021Quote: ... Cell viability was monitored by measuring lactate dehydrogenase (LDH) leakage into the culture medium by using the CytoTox96 Non-Radio Cytotoxicity Assay kit (Promega). For adherent cells (HFFs ...
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of macrophages after 8 hours of infection was quantified by measuring the release of the enzyme lactate dehydrogenase in cell supernatants using the CytoTox 96 Non-Radioactive Cytotoxicity Assay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Cell death was assessed by measuring lactate dehydrogenase (LDH) release into the supernatant using a CytoTox 96 Non-Radioactive Cytotoxicity Assay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... gondii glyceraldehyde 3-phosphate dehydrogenase 2 (GAPDH2, ML5049/ML5680) or TgAPT1 (ML4097/ML4098) were used for subsequent PCR amplification with GoTaq polymerase (Promega) for twenty-five cycles as follows ...
-
bioRxiv - Cell Biology 2022Quote: ... Lactate dehydrogenase (LDH) release was measured using the Cyto Tox 96 © Non-Radioactive Cytotoxicity Assay (Promega, Madison, Wisconsin, USA) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: In vitro cytotoxicity was determined by measuring lactate dehydrogenase (LDH) release upon cell lysis according to the manufacturer’s instructions (Promega, G1780). In brief ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were incubated for 24hr at 37°C and cell death was measured through a lactate dehydrogenase (LDH) assay using the CytoTox 96 kit (Promega). 50 μL of media was collected from all experimental wells with two replicates each and placed in a fresh 96-well plate ...
-
bioRxiv - Microbiology 2024Quote: Lytic cell death was indirectly studied by measuring lactate dehydrogenase (LDH) release in cell culture medium using the CytoTox 96 nonradioactive cytotoxicity assay kit (G1780, Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... The supernatants were used to determine lactate dehydrogenase activity and IL-1β level using LDH-GloTM Cytotoxicity Assay (Promega, J2380) and Mouse IL-1 beta DuoSet ELISA (R&D Systems ...
-
bioRxiv - Neuroscience 2024Quote: The short TMEM106B 3’ UTR and the long TMEM106B 3’ UTR were amplified from human genomic DNA (H1) and then cloned into the pmirGLO Dual-Luciferase Vector (Promega, E1330) using Gibson assembly ...
-
bioRxiv - Synthetic Biology 2023Quote: ... His-tag proteins have been purified by using MagneHis system (Promega) and DynaMag spin magnet (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... HiBiT-tagged proteins were detected using the Nano-Glo HiBiT blotting system (Promega) according to the manual ...
-
bioRxiv - Biochemistry 2023Quote: Stable COMT cell lines were transfected with Myc-tagged ubiquitin using FugeneHD (Promega) following the manufacturer’s instructions using 4 μg plasmid ...
-
bioRxiv - Neuroscience 2021Quote: Cell cytotoxicity was detected by measuring lactate dehydrogenase (LDH) levels using the CytoTox 96® Non-Radioactive Cytotoxicity Assay (Promega, G1780). The manufacturer’s instructions were followed and the absorbance reflecting the LDH content in the cell supernatant was measured at 492 nm (600 nm reference ...
-
bioRxiv - Molecular Biology 2021Quote: ... The release of lactate dehydrogenase (LDH) into the cell culture medium was quantified by bioluminescence using the LDH-Glo™ Cytotoxicity Assay kit (Promega). 10% Triton X-100 was added to untreated cells for 15 minutes to determine the maximum LDH release ...
-
bioRxiv - Biophysics 2021Quote: ... We detected the cytotoxicity by a lactate dehydrogenase (LDH) assay using the Cytotox 96 non-radioactive cytotoxicity assay kit (Promega, USA) according to the kit instructions ...
-
bioRxiv - Neuroscience 2020Quote: 50 μl supernatant were collected as designed time point into a 96-well plate for lactate dehydrogenase (LDH) release assay as manufacture’s protocol (Promega, cat# G1780). Briefly ...
-
bioRxiv - Immunology 2019Quote: ... Cytotoxicity was then measured from cell supernatants based on release of lactate dehydrogenase (LDH) released from dying cells based on the CytoTox 96® Non-Radioactive Cytotoxicity assay from Promega and done according to manufacture protocol ...
-
bioRxiv - Pathology 2019Quote: ... Lactate Dehydrogenase (LDH) release was measured regularly (twice per week) using a CytoTox 96® Non-Radioactive Cytotoxicity Assay kit (Promega).
-
bioRxiv - Neuroscience 2020Quote: Cell cytotoxicity was detected by measuring lactate dehydrogenase (LDH) levels using the CytoTox 96® Non-Radioactive Cytotoxicity Assay (Promega, G1780). The manufacturer’s instructions were followed and the absorbance reflecting the LDH content in the cell supernatant was measured at 492 nm (600 nm reference ...
-
bioRxiv - Cancer Biology 2022Quote: ... by quantifying the activity of lactate dehydrogenase (LDH) released into the supernatant using a colorimetric assay (CytoTox 96® Non-Radioactive Cytotoxicity Assay kit from Promega) and following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: Cytotoxicity was assessed by measuring the lactate dehydrogenase (LDH) release from cells with damaged membranes using the CytoTox-ONE Homogeneous Membrane Integrity assay (#7891, Promega, USA). For this ...
-
bioRxiv - Microbiology 2024Quote: ... Treatments did not affect bacterial or cell viability as assessed by Lactate dehydrogenase release in the culture supernatant (LDH cytotoxicity kit®, Promega, according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-untranslated region (3’-UTR) fragment of IκBα (human/rat) was inserted into the pGL3-basic vector (firefly luciferase; Promega, Madison, WI, USA), which was obtained from General Biosystems (Anhui ...
-
bioRxiv - Neuroscience 2021Quote: ... after which D-luciferin-specific Quantilum Recombinant Luciferase (Promega) was added to a final concentration of 25 μg/mL ...
-
bioRxiv - Plant Biology 2019Quote: ... and 20 units of recombinant Rnasin RNase inhibitor (Promega) in a final volume of 20 µl ...