Labshake search
Citations for Promega :
101 - 150 of 2771 citations for DIRAS Family GTP Binding RAS Like 1 DIRAS1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Secondary antibodies conjugated to horseradish peroxidase (1:10,000, W401B and W402B, Promega) were applied in the same solution for one hour at room temperature before activity was detected (SuperSignal West Pico PLUS 34580 ...
-
bioRxiv - Genetics 2021Quote: ... the following antibodies were used: mouse anti-beta-galactosidase (Promega; 1:100), mouse anti-Mmp1 (1:1:1 mixture of DSHB 3A6B4 ...
-
bioRxiv - Microbiology 2023Quote: ... followed by horseradish peroxidase-conjugated (HRP) secondary rabbit antibodies (Promega, 1/25000) and revealed by chemiluminescence (Pierce ...
-
bioRxiv - Biochemistry 2022Quote: ... membrane was incubated with anti-HaloTag antibody (1:1000; Promega Corporation; G9281) and then with anti-Rabbit IgG Horseradish Peroxidase linked whole antibody (1:5000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... secondary antibodies: anti-rabbit HRP or anti-mouse HRP (Promega, 1:10000).
-
bioRxiv - Biochemistry 2023Quote: ... Secondary antibodies used were: anti-rabbit-IgG-HRP (W401B, 1:8000, Promega); anti-mouse-IgG-HRP (W402B ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by HRP-conjugated secondary anti-mouse antibody (1:5000, Promega W402B), diluted as indicated ...
-
bioRxiv - Neuroscience 2020Quote: ... membranes were incubated for 1 hour at room temperature with an HRP-conjugated secondary antibody (1:1000, Promega). Protein expression was revealed using the Clarity kit (Biorad) ...
-
bioRxiv - Neuroscience 2022Quote: ... For immunostaining of the induced neurons following antibodies were used: anti-Tuj 1 (mouse; 1:2000, G7121, Promega), anti-MAP2 (chicken ...
-
bioRxiv - Molecular Biology 2024Quote: ... The secondary antibodies used included goat anti-rabbit IgG HRP-conjugated antibody (1:5,000, #7074S, CST) and goat/rabbit/donkey anti-mouse IgG HRP Conjugate (1:5,000, #W402B, Promega). The membranes for streptavidin blotting were blocked with 3% BSA ...
-
bioRxiv - Microbiology 2019Quote: The following commercial antibodies and dilutions were used for immunofluorescence staining: rabbit polyclonal antibody to HaloTag (Promega; G9281; 1:500 dilution), mouse monoclonal antibody to lamin A/C (Cell Signaling ...
-
bioRxiv - Molecular Biology 2021Quote: The minimal CYC1 promoter with seven tetracycline binding sites was amplified from the yeast Tet-Promoters collection35 with YG4866/YG4867 and cloned into pGEM-Teasy (Promega) to create pCB4695 ...
-
bioRxiv - Microbiology 2020Quote: ... containing the specific primers-probe binding sites were synthesized for NoV GII and cloned into the pGEM-T Vector (Promega) resulting in the NoV-GII plasmids ...
-
bioRxiv - Molecular Biology 2019Quote: Validation of hsa-miR-548ba and hsa-miR-7973 direct binding to target gene 3’UTR was performed by using Dual-Glo Luciferase assay system (Promega) according to the user manual ...
-
bioRxiv - Genomics 2020Quote: ... Viral RNA was extracted using the silica guanidinium isothiocyanate binding method (12) adapted for the ThermoFisher Kingfisher using paramagnetic silica particles (Magnesil, Promega).
-
bioRxiv - Developmental Biology 2019Quote: ... together with a TOPFLASH luciferase reporter construct containing synthetic Tcf-binding sites (Korinek et al., 1998) and a Renilla-luciferase reporter (Promega) for normalization ...
-
bioRxiv - Evolutionary Biology 2020Quote: To generate the pGl3-STK38-P luciferase reporter,1.2 kb of DNA upstream the STK38 TTS promoter region with ZNF611 binding motif was amplified by polymerase chain reaction (PCR) and cloned into the Firefly luciferase reporter plasmid pGL3-Basic (Promega) using KPN1 and XHO1 restriction sites.0.7 kb of DNA upstream the STK38 TTS promoter region without ZNF611 binding motif was cloned into pGL3-Basic using same restriction sites to generate the pGl3-STK38-ΔP luciferase reporter ...
-
bioRxiv - Microbiology 2022Quote: ... containing the specific primers-probe binding sites were synthesized for NoV GII and cloned into the pGEM-T Vector (Promega), resulting in the NoV-GII plasmids ...
-
bioRxiv - Immunology 2020Quote: ... 1:3,000 dilution of HRP-conjugated anti-mouse IgG secondary antibody (W402B, Promega) was added and incubated for one additional hour ...
-
bioRxiv - Microbiology 2021Quote: ... Immunodetection was carried out using rabbit polyclonal anti-Halo antibody (Promega; 1:1000), mouse anti-HA antibody (Roche ...
-
bioRxiv - Developmental Biology 2020Quote: ... The primary antibodies that were used are mouse β-Gal (1:250; Promega), mouse anti-Cora C615.16 (1:400 ...
-
bioRxiv - Developmental Biology 2021Quote: The antibodies used were: Rabbit anti-pJNK pTPpY (1:500, Promega, Cat#V93B), Rat anti-Ci(1:1,000 ...
-
bioRxiv - Microbiology 2022Quote: ... Secondary anti-mouse IgG HRP antibody was used at 1:7000 dilution (Promega). ChemiDoc (Bio-Rad ...
-
bioRxiv - Developmental Biology 2023Quote: ... and rabbit anti-Caspase-3 polyclonal antibody (1:250, Promega/Fisher, PR-G7481) overnight at 4 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... We used the following primary antibodies: mouse anti-LacZ (1:500 dilution, Promega) rabbit polyclonal anti-cleaved Caspase 3 (1:200 dilution ...
-
bioRxiv - Genomics 2024Quote: ... Membranes were then incubated with 1:10000 HRP-conjugated secondary antibody (Promega #W402B) in TBST + 5% milk for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibody against HaloTag® (G9211; 1:1000) was purchased from Promega (UK).
-
bioRxiv - Molecular Biology 2023Quote: ... The secondary antibody was a horseradish peroxidase polyclonal goat anti-mouse (from 1:5,000 to 1:10,000, depending on the primary antibody; Promega, W4021). Proteins were detected with the ECL chemiluminescence reagent (GE Healthcare ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated with the primary antibodies (1D4 1:1500, Anti-Calnexin Sigma c4731 1:600, Anti-LgBiT Promega N7100 1:100 ...
-
bioRxiv - Cancer Biology 2021Quote: ... For these experiments pGL2M4-luc reporter plasmid37 (containing four CACGTG binding sites, a canonical E-box) and pRL Renilla Luciferase Control Reporter Vectors (CMV, Promega E2231) were used ...
-
bioRxiv - Cancer Biology 2021Quote: MAGI2-AS3 or FOXN3 3’UTR containing miR-452-5p wild-type (WT) or mutant (MUT) binding sites were inserted into psiCHECK vector (Promega, USA). 293T cells were transfected with the constructed luciferase plasmid together with miR-NC or miR-452-5p mimics using Lipofectamine 2000 ...
-
bioRxiv - Developmental Biology 2021Quote: A partial TWD1 fragment of 150 bp covering the TPR domain and a part of the calmodulin binding domains (aa 264-314) was PCR amplified and cloned into pGEM-T-Easy Vector (Promega Corp.) and verified by sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... or without (150 bp) one putative ETV2 binding site (Wei et al, 2010) were cloned into pGL3_Basic vector (Cat# E1751, Promega, Madison, WI). Primers Forward ...
-
bioRxiv - Cell Biology 2021Quote: ... of miR-148a putative binding sites reporter plasmids were constructed using the circMRPS35 and 3’-UTR of STX3 sequences in the psiCHECK2 vector (Promega, USA). For IRES activity analysis ...
-
bioRxiv - Molecular Biology 2019Quote: The 3’ UTR of target mRNAs spanning at least 500 bp around the predicted miRNA binding sites were cloned into the psi-CHECK2 vector (Promega, C8021) downstream of the Renilla luciferase gene (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: FOXM1 3’UTR region comprising of miRNA binding region was cloned into pmirGLO-Dual Luciferase miRNA target expression vector for miRNA luciferase reporter assay (Promega, USA) in MCF-7 cell lines ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2022Quote: ... as primary antibodies and anti-mousse IgG-HRP conjugated secondaries antibodies (Mouse IgG, HRP conjugate W402B, Promega; 1/5000 in TBST, 4 hours). As a loading control we used anti-tubulinα antibodies as primary antibodies (1/1000 in 5 % milk over-night) ...
-
bioRxiv - Cell Biology 2020Quote: ... We used the following primary antibodies: mouse anti-β-galactosidase (Promega, 1:1,000 dilution), rabbit anti-GFP (MBL,1:1,000 dilution) ...
-
bioRxiv - Cancer Biology 2022Quote: ... After 1h of incubation with a horseradish peroxidase-conjugated secondary antibody (1:3,000, Promega), protein bands were visualized using an enhanced chemiluminescence detection kit (Millipore ...
-
Multiple steps mediate ventricular layer attrition to form the adult mouse spinal cord central canalbioRxiv - Developmental Biology 2019Quote: ... Probe was detected using alkaline phosphatase-labelled anti-digoxigenin antibody (1:1000, Promega, 11093274910) in blocking buffer at 4°C overnight ...
-
bioRxiv - Plant Biology 2019Quote: ... The secondary antibody was an anti-mouse coupled to HRP 1:10,000 (W4021, Promega). Detection was performed with the Pico Plus system (34580 ...
-
bioRxiv - Neuroscience 2021Quote: ... USA) at 1:10 dilution and polyclonal HaloTag antibody (Promega Corp. Madison, WI, USA) at 1:500 dilution and FITC-conjugated donkey anti-mouse secondary antibody and Cy3-conjugated goat anti-rabbit secondary antibody (Invitrogen).
-
bioRxiv - Neuroscience 2020Quote: ... overnight at 4°C and HRP-conjugated anti-rabbit antibody (1:2,000, W4011, Promega) for 1 hr at room temperature followed by ECL signal amplification and chemiluminescence detection (SuperSignal West Pico Chemiluminescent Substrate ...
-
bioRxiv - Pathology 2021Quote: ... and anti-rabbit IgG antibody coupled to horseradish peroxidase (Promega France, W401B, 1/2500) and revealed with the Western Lightning chemiluminescence reagent Plus (PerkinElmer Life Sciences) ...
-
bioRxiv - Neuroscience 2023Quote: ... Secondary antibodies used for western blot include anti-Rabbit-HRP (1:20000, Promega W4011); anti-Mouse-HRP (1:20000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by overnight incubation with primary antibodies rabbit anti-HaloTag (1:500, G9281, Promega) and mouse anti-LaminB1 (0.5ug/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... and the sequence encoding a genetically modified firefly luciferase into which a cAMP-binding domain has been inserted from the pGloSensor-20F (Promega, Cat #E1171).
-
bioRxiv - Cancer Biology 2020Quote: The wild-type 3’UTR region of SALL4 mRNA or a mutant without the miR-205 binding site (Figure 4E) was amplified using PCR and cloned into the pGL3 vector (Promega, Madison, USA). HEK 293T cells were seeded into 24-well plates ...
-
bioRxiv - Bioengineering 2021Quote: ... Cell lysates were pre-cleared of any non-specific streptavidin-binding proteins by incubating with 60 µL of MagneSphere paramagnetic particles (Promega, Madison, WI) for 30 min with rotation ...