Labshake search
Citations for Promega :
101 - 150 of 6133 citations for 2'3' Cyclic GAMP cGAMP ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR reactions using the GoTaq 1-Step RT-qPCR kit (Promega) were set-up to 10 µl final reaction volumes according to the manufacturer’s instructions containing 250 nM of each receptors primer pairs and 10 ng of RNA ...
-
bioRxiv - Microbiology 2019Quote: ... 10µL of the sample was added in triplicate to a 96 well opaque white plate (Pierce) and analysed on the plate reader using Stop and Glo reagents (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Samples were scored using 20μL aliquots loaded into a 96-well plate and run on a GloMax Explorer Multimode Plate Reader (Promega GM3500) using the kit-provided reagents and protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The following day cells were trypsinized and seeded in 384-well white plate (20 µl/well) in DMEM F12 (no phenol red, 4% FBS) +/-HaloTag® NanoBRET™ 618 Ligand (1 µl/ml, Promega) and +/-compounds (DMSO concentration in each sample was kept the same) ...
-
bioRxiv - Cancer Biology 2024Quote: ... measurements 1×105 T cells were cultured in white 96 well plate and analysed using NAD/NADH-Glo™ luminescent assay (Promega, G9071), according to the manufacturer instructions ...
-
bioRxiv - Bioengineering 2023Quote: The 36PillarPlate with HLOs was sandwiched with an opaque white 384-well plate containing 20 μL of CellTiter-Glo® Reagent from CellTiter-Glo® cell viability kit (Promega, Madison, WI, USA) and 20 μL of cell culture medium in each well to measure cellular adenosine triphosphate (ATP ...
-
bioRxiv - Immunology 2021Quote: ... The GloMax Explorer plate reader (Promega, Madison, WI) along with GraphPad Prism v9 were used to analyze the plates.
-
bioRxiv - Genetics 2022Quote: ... measured on the GloMax Discover plate reader (Promega). BAR:Luciferase and Tk:Renilla plasmids were kind gifts from the lab of Ben Major51 ...
-
LIR-dependent LMX1A/LMX1B autophagy crosstalk shapes human midbrain dopaminergic neuronal resiliencebioRxiv - Cell Biology 2019Quote: ... Fluorescence was measured in Glomax plate reader (Promega) with the UV module (365nm excitation and 410–465 emission) ...
-
bioRxiv - Cancer Biology 2019Quote: ... using a Glomax Explorer luminescence plate reader (Promega). All drug-dose-cell line combinations were performed in quadruplicates and viabilities were reported as mean (+/− S.D. ...
-
bioRxiv - Genetics 2021Quote: ... Luminescence was recorded using GloMax plate reader (Promega). The analysis was performed on biological triplicates ...
-
bioRxiv - Bioengineering 2022Quote: ... was performed to measure the specific killing activity of anti-HIV CAR-T cells toward LHL2/3 cells and LEL6 cells at different ratios from 1:1 to 10:1 by using the CytoTox 96 non-radioactive cytotoxicity kit (Promega, Madison, WI, United States) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2021Quote: ... the culture medium was removed and treated with caspase-1 assay kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: Senescence was measured using 2 assays: 1/ Beta-Glo Assay kit (Promega # E4720), according to the manufacturer’s instructions and utilizing a luciferin-galactoside substrate (6-O-β galactopyranosylluciferin) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were plated in 24-well plate or 6-well plate and transfected next day using FuGENE® 6 (Promega, E2691). For luciferase assay ...
-
bioRxiv - Microbiology 2023Quote: ... In Ghent the optical density was measured by diluting the culture in phosphate-buffered saline in a 96-well microtiter plate and measuring the turbidity in a plate reader at 600 nm (GloMax® Explorer Multimode Microplate Reader, Promega).
-
bioRxiv - Cancer Biology 2021Quote: ... luciferase assay reagent was mixed in a 1:1 ratio with cell lysate (Luciferase Assay System kit, Promega, Madison, WI). Luciferase activity was measured with Synergy H4 Hybrid Reader (BioTek ...
-
bioRxiv - Biophysics 2021Quote: ... The 96-well reaction plate was read using the ADP-Glo™ Luminescence Protocol on a GloMax plate reader (Promega; Cat# E7031).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 100 µL of the developed reagent was transferred to a solid white 96-well assay plate and fluorescence was read using a multi-modal plate reader (Ex 520nm/Em 580nm; GloMax Explorer, Promega, WI, USA).
-
bioRxiv - Microbiology 2023Quote: ... The plate was incubated in a plate reader (Amsterdam: Multiskan microplate photometer, Thermo Fisher; Ghent University: GloMax® Explorer Multimode Microplate Reader, Promega) at 37 °C and absorption was measured at 600 nm ...
-
bioRxiv - Molecular Biology 2021Quote: ... and measured on the GloMax Discover plate reader (Promega).
-
bioRxiv - Systems Biology 2021Quote: ... desalted (Oasis HLB 5mg Plate) and digested by Promega trypsin overnight ...
-
bioRxiv - Microbiology 2020Quote: ... plate reader according to the manufacturer’s instructions (Promega, NanoGlo). For our 100% inhibition control ...
-
bioRxiv - Cell Biology 2022Quote: ... Fluorescence was measured with Glomax Multi plate reader (Promega).
-
bioRxiv - Microbiology 2022Quote: ... measured in triplicate using a GloMax plate reader (Promega). Bacterial attachment to roots is expressed as Relative Light Units (RLU)/g of root [12] ...
-
bioRxiv - Microbiology 2023Quote: ... Plates were washed in PBS/0.05% Tween 20 (Promega) and then blocked with blocking buffer solution (PBS/0.05% Tween 20 /3% non-fat milk (AmericanBio ...
-
bioRxiv - Plant Biology 2023Quote: ... under the GloMax Discover plate reader system from Promega. Primers used in the dual-LUC assays were given in Supplementary Table 8.
-
bioRxiv - Molecular Biology 2023Quote: ... Luminescence was measured on a GloMax plate reader (Promega). Three technical measurements were performed for each of three biological replicates ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 μg cellular RNA was treated with DNase (RQ1 Rnase-Free DNase kit Promega) and reverse-transcribed following the GoScript ™ Reverse Transcriptase Kit (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... and the 200 nM GoTaq® Probe 1-Step RT-qPCR System Kit (Promega). This kit uses GoTaq Probe qPCR Master Mix with dUTP (10 uL) ...
-
bioRxiv - Systems Biology 2024Quote: ... coagulans DSM 1 = ATCC 7050 was extracted using Wizard Genomic DNA Purification Kit (Promega) according to the protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... washed with PBS and inflammasome activation was assessed using qPCR or inflammasome caspase-1 activity was measured using Caspase-Glo® 1 inflammasome assay kit (G9951; Promega) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... viable cells were quantified in a FLUOstar OPTIMA ELISA reader (550/590 nm) about 2 h after CellTiter-Blue staining (Promega, Cat No. G8081). Mean values +/-standard deviations (SD ...
-
bioRxiv - Immunology 2020Quote: ... and cDNA synthesized from 1 µg total RNA (High Capacity cDNA Reverse Transcription Kit, Promega). Quantitative RT-PCR was performed using FluoCycle II SYBR Master Mix (EuroClone ...
-
bioRxiv - Neuroscience 2024Quote: ... using BRYT Green Dye contained in the GoTaq 1-Step RT-qPCR kit (Promega: A6020) in the CFX96 Touch Real-Time PCR Detection system (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plates were imaged using a GloMax Discover Microplate Reader (Promega). Analysis and statistical test were performed using Microsoft Excel.
-
Molecular profiling of driver events and tumor-infiltrating lymphocytes in metastatic uveal melanomabioRxiv - Cancer Biology 2019Quote: ... the luminescence was measured with GloMax Discover plate reader (Promega). In parallel the manual cell count was performed using Trypan blue staining of cells obtained from transfections in 12-well format.
-
bioRxiv - Neuroscience 2020Quote: ... plates were processed with a luciferase assay (One-Glo, Promega) and luminescence was detected in a microplate reader (Synergy H1 ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were removed and 50 μl of CellTiter-Glo (Promega) was added to each well ...
-
bioRxiv - Genomics 2021Quote: ... The DNA was quantified using a GloMax Plate Reader (Promega).
-
bioRxiv - Genetics 2020Quote: ... Plates were read using a GloMax Multi-Detection System (Promega).
-
bioRxiv - Microbiology 2020Quote: ... Growth curves were obtained using a GloMax plate reader (Promega).
-
bioRxiv - Microbiology 2021Quote: ... The plate was analysed using the GloMax multidetection system (Promega).
-
bioRxiv - Immunology 2021Quote: ... Plates were then read using the GloMax® Navigator (ProMega) using the Promega GloMax® Luminiscence Quick-Read protocol ...
-
bioRxiv - Immunology 2022Quote: ... Plates were read for luminescence using the GloMax system (Promega) with pre-installed settings.
-
bioRxiv - Genomics 2022Quote: ... Plates were read on a GloMax 96 Microplate Luminometer (Promega) using the standard CellTiterGlo program.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Samples were quantified using the GloMax Plate Reader System (Promega) using the QuantiFluor® dsDNA System (Promega) ...
-
bioRxiv - Neuroscience 2023Quote: ... plates were injected with 25 μl of GloSensor substrate (Promega) and incubated for 2 h in the dark at room temperature and in an odor-free environment ...
-
bioRxiv - Biochemistry 2022Quote: ... plates were injected with 25 μl of GloSensor substrate (Promega) and incubated for 2 hours in the dark at room temperature and in a odor-free environment ...