Labshake search
Citations for Promega :
1401 - 1450 of 2545 citations for Astrovirus Antigen Type 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were then diluted to 1 M urea with water and digested with trypsin (Promega) overnight at 37°C at a ratio of 1 μg of trypsin per 10 μg of protein for homogenate and cytosol samples while for light membranes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5ng ml-1 recombinant human fibroblast growth factor (rhFGF) (Promega, Cat#G5071, Madison, WI, USA), and 1% chicken embryonic extract (Seralab ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR technique was performed according to GoTaq®1-Step RT-qPCR (Promega, USA) kit instructions ...
-
bioRxiv - Genomics 2021Quote: ... cDNA was synthesised from 1 μg of total RNA using random primers (Promega, Wisconsin, USA) then treated with M-MLV Reverse Transcriptase (Pro-mega ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... DLD-1 cells were transfected with the guide and donor plasmids using Viafect (#E4981, Promega) reagent ...
-
bioRxiv - Developmental Biology 2022Quote: ... The 50μg of proteins were then trypsin digested overnight at 37 °C (1:25; Promega) using the filter aided sample preparation (FASP ...
-
bioRxiv - Cancer Biology 2022Quote: ... PD-L1 neutralization was done in a PD-1/PD-L1 Blockade Bioassay (J1250, Promega).
-
bioRxiv - Cell Biology 2022Quote: ... or secondary antibodies: anti-mouse IgG horseradish peroxidase (HRP) (Promega, Madison, WI, W402B, 1:10,000), anti-rabbit IgG HRP (Promega ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1 µl of crude DNA lysate was used with 2x GoTaq Reaction Mix (Promega M7123) supplemented with 5% DMSO.
-
bioRxiv - Molecular Biology 2022Quote: ... Compound treatment was initiated 1-4 hours before transfections with FuGENE HD transfection reagent (Promega) following the manual ...
-
bioRxiv - Immunology 2022Quote: ... 24 h following stimulation with IFN cells were harvested in 1 × passive lysis buffer (Promega) and stored at −20°C ...
-
bioRxiv - Cell Biology 2022Quote: ... HAT-MBP-ZNF518B770-987 was extracted using above buffer including 1% Tween 20 (#H5152, Promega). The target proteins were affinity-purified using Ni-NTA agarose (#143-09763 ...
-
bioRxiv - Microbiology 2023Quote: ... and digestion for 18 hours with 1 µg of TPCK- trypsin (Promega, Madison, WI, USA) in presence of 10% acetonitrile (ACN) ...
-
bioRxiv - Microbiology 2023Quote: ... vigorously vortexed for 1 min and mixed with 40 μL of Proteinase K Solution (Promega France ...
-
bioRxiv - Microbiology 2023Quote: ... vigorously vortexed for 1 min and mixed with 40 μL of Proteinase K Solution (Promega France ...
-
bioRxiv - Pathology 2023Quote: ... RNA (1 µg) was reverse transcribed using GoScript Reverse Transcription System (A5001, Promega, Madison, WI). cDNA was measured by quantitative PCR with FastStart Universal SYBR Green Master (Rox ...
-
bioRxiv - Molecular Biology 2023Quote: ... membranes were washed and incubated with the appropriate HRP-conjugated secondary antibody (Promega, 1:3000) and the reaction was finally visualized with the Western Blotting Luminol Reagent (Santa Cruz Biotechnology) ...
-
bioRxiv - Biochemistry 2022Quote: ... Proteins were extracted by methanol-chloroform precipitation and digested with 1 μg of trypsin (Promega) in 100 mM EPPS (pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: ... Secondary antibody labeling was completed using anti-rabbit IgG-HRP conjugate (1:10,000; Promega W401B) by incubating membranes for 2 h at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Quantitative PCR (qPCR) reactions included 10 μl 1 X GoTaq® qPCR Master Mix (Promega), 0.5 μM of each primer and 5 μl template cDNA ...
-
bioRxiv - Biochemistry 2023Quote: ... with 25 μL of diluted reactions (diluted 1:5 in Glo Lysis Buffer; Promega # E2661) and incubated at room temperature for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mM DTT) buffer and luminescence activity was measured with the Luciferase Assay System (Promega).
-
bioRxiv - Microbiology 2023Quote: ... followed by overnight digestion with trypsin (enzyme to protein ratio of 1:100) (Promega, Germany) at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Secondary antibodies used included alkaline phosphatase-conjugated anti-rabbit IgG antibody (1:1,000, #S3738, Promega) and anti- mouse IgG antibody (1:1,000 ...
-
bioRxiv - Genomics 2023Quote: ... 1 μg of total RNAs was reverse-transcribed using ImProm-IITM Reverse Transcription System (Promega) and genes were analysed with Quantifast SYBR green master mix (Qiagen) ...
-
bioRxiv - Cell Biology 2023Quote: ... Sequencing of the gRNA-targeted exon 1 was performed by PCR amplification (Promega GoTaq polymerase) with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al. ...
-
bioRxiv - Microbiology 2023Quote: Viral loads were quantified using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-COV-2 the nCOV_N1 primer/probe mix from the SARS-CoV-2 (2019-nCoV ...
-
bioRxiv - Biophysics 2023Quote: ... Cross-linked samples for XL-MS were digested by 1:50 (m/m) trypsin (Promega) overnight at 37 °C while shaking at 600 rpm ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA (1 μg per reaction) was reverse transcribed using the GoScript Reverse Transcription System (Promega). Following reverse transcription ...
-
bioRxiv - Immunology 2023Quote: ... Complementary DNA (cDNA) was generated using 1 μg RNA using M-MLV Reverse Transcriptase (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were digested overnight at 37° C with 1 μg mass spectrometry grade Trypsin (Promega). The resulting peptide sample was acidified with 10% formic acid and 10% trifluoroacetic acid (TFA ...
-
bioRxiv - Immunology 2023Quote: ... horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG antibody (1:10000) (Promega, Madison, WI, USA), diluted in 3% (w/v ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 µL of enzyme mix (lysC & trypsin, 10 ng/µL in water, Promega, Cat. V5072) was dispensed into each well by using the pL-volume dispensing function of the cellenONE at 20°C and 85% humidity ...
-
bioRxiv - Microbiology 2023Quote: ... 0.25 µl 1 M MgCl2 and 0.3 µl Rnasin ribonuclease inhibitor (Promega, 0.4 u/µl) in a final volume of 30 µl at 25°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... Bound antibodies were detected using the appropriate horseradish peroxidase-conjugated secondary antibodies (1:10000, Promega). Chemiluminiscent signals were detected with an ECL Prime Western blotting detection kit (GE Healthcare ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein detection was done using primary antibody anti-HaloTag monoclonal antibody (1:1,000 dilution, Promega), primary antibody anti-MamE polyclonal antibody (1:3,000 dilution ...
-
bioRxiv - Plant Biology 2023Quote: High concentration (1 µg/µL) plasmid DNA was extracted via maxi-prep (Promega SV Wizard). Lower quality plasmid DNA (e.g ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were again diluted to 2 M urea and digested with 1 µg trypsin (Promega) (1/100 ...
-
bioRxiv - Biochemistry 2024Quote: ... Then membranes were incubated with secondary anti-rabbit IgG horse radish peroxidase (Promega, 1:5000) for 1 hour ...
-
bioRxiv - Systems Biology 2023Quote: The transfections were performed with a 1 mg DNA: 2 ml Fugene HD (Promega E2311) ratio ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Viral loads were quantified using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-COV-2 the nCOV_N1 primer/probe mix from the SARS-CoV-2 (2019-nCoV ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein samples eluted with biotin were digested in-solution with 1 ug Trypsin/LysC (Promega) overnight at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... The blot was probed with 1:1000 dilution of anti-NLuc antibody (Promega cat#7000) and the bands detected by chemiluminescent detection.
-
bioRxiv - Neuroscience 2024Quote: ... using BRYT Green Dye contained in the GoTaq 1-Step RT-qPCR kit (Promega: A6020) in the CFX96 Touch Real-Time PCR Detection system (Bio-Rad) ...
-
bioRxiv - Microbiology 2024Quote: ... at an enzyme-to-substrate ratio of 1:20 and protease max 0.1% (Promega, UK). Digestion was carried out overnight at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: Twenty µg of lyophilized deglycosylated DG390 was digested by 1 µg MS grade trypsin (Promega) in a 50 mM ammonium bicarbonate buffer (pH=8.4 ...
-
bioRxiv - Biochemistry 2024Quote: ... and mixed with the nanoluciferase substrate Nano-Glo (Promega cat# N1120, final dilution 1:200) for 2 min before measuring luminescence in a POLARstar OMEGA plate reader (BMG Labtech ...
-
bioRxiv - Immunology 2023Quote: ... followed by goat anti-mouse immunoglobulin conjugated to alkaline phosphatase (Promega S3721, dilution 1:7500). Focuses of infection were revealed using NBT/BCIP reagent (Promega) ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized from 1 μg of each RNA sample using Oligo(dT)15 Primer (Promega) and M-MLV Reverse Transcriptase (RNase H Minus ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µL cDNA was used as template for 25 cycles of PCR using GoTaq polymerase (Promega) targeting the TMV replicase using forward primer 5’ CCGCGAATCTTATGTGGAAT 3’ and reverse primer 5’ TCCTCCAAGTGTTCCCAATC 3’ ...