Labshake search
Citations for Promega :
1351 - 1400 of 3646 citations for Mouse Alpha ketoglutarate dependent dioxygenase FTO FTO ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 35 and 42 were extracted with Wizard® Genomic DNA purification kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... was measured using the Caspase-Glo-3/7 kit ((Promega, Madison, WI, USA). The luminescence assay was measured using Biotek Synergy H1 microplate reader (Biotek ...
-
bioRxiv - Bioengineering 2021Quote: ... was measured using the RealTime-Glo MT Cell Viability kit (Promega, Catalog #G9711). Both measures were repeated for three separate wells ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fragments excised from the gel purified by the DNA Purification kit (Promega) according to the maker instructions.
-
bioRxiv - Biochemistry 2020Quote: ... Luciferase activity was then measured using a commercial dual luciferase assay kit (Promega), after which firefly luciferase activity was normalized to Renilla activity and the values for the control groups were set to one.
-
bioRxiv - Biochemistry 2020Quote: ... viability was measured using the CellTiter-Glo 2.0 Cell Viability Assay kit (Promega) in the same conditions.
-
bioRxiv - Plant Biology 2021Quote: ... APOLO was transcribed using the T7 transcription kit (Promega; (Ariel et al., 2020)) ...
-
bioRxiv - Neuroscience 2020Quote: ... and luciferase signals were measured with Dual-Glo® Luciferase assay kit (Promega) using GENios pro plate reader (Tecan) ...
-
bioRxiv - Cancer Biology 2021Quote: ... the luciferase assay was performed using Dual-Luciferase Reporter Assay System kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... TUNEL staining on tissue sections was performed using the DeadEnd™ kit (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2020Quote: Assessed using Cell Titer-Glo Luminescent Viability Assay kit (Promega Corporation, Madison, WI).
-
bioRxiv - Neuroscience 2019Quote: ... briefly genomic DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega) and digested with the XbaI restriction enzyme (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... luciferase activity was measured with a Dual-luciferase reporter assay kit (Promega, USA).
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted using the Wizard DNA Purification kit (Promega, Madison, Wisconsin) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was extracted using the SV Total RNA Isolation kit (Promega, Wisconsin, USA). RNA was DNase treated using the Turbo DNase kit (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... Bioluminescence generated by Gaussia luciferase was measured using the Renilla luciferase kit (Promega) on a FLUOstar Omega plate reader (BMG Labtech) ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was extracted using the Wizard® Genomic DNA Purification Kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and genomic DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega), following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... Santiago-089 was extracted using the Wizard genomic DNA purification kit (Promega, USA) and sequenced at MicrobesNG (University of Birmingham ...
-
bioRxiv - Molecular Biology 2021Quote: ... Yeast genomic DNA was isolated using a Wizard Genomic DNA Purification Kit (Promega) and digested with XhoI ...
-
bioRxiv - Molecular Biology 2020Quote: ... we used the CellTiter 96 AQueous One Solution Cell Proliferation Assay kit (Promega) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was extracted using a Maxwell 16 Cell DNA Purification Kit (Promega). Genomic DNA libraries were prepared using a Nextera XT kit (Illumina ...
-
bioRxiv - Pathology 2021Quote: ... Total RNA extraction was performed using the SV RNA Isolation System Kit (Promega), following the manufacturers’ recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... Cytotoxicity was quantified colorimetrically with the CytoTox96 lactate dehydrogenase (LDH)-release kit (Promega). The percentage of cytotoxicity was calculated with the formula ...
-
bioRxiv - Microbiology 2021Quote: ... and genomic DNA was isolated using the Wizard Genomic DNA Purification Kit (Promega). qPCR reactions of 10 µL were set up with 5 µL PowerUpTM SYBRTM Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2020Quote: ... and chromosomal DNA was prepared using the Wizard Genomic DNA Purification Kit (Promega).
-
bioRxiv - Cancer Biology 2020Quote: Cell viability was determined by CellTiter 96 aqueous one solution proliferation kit (Promega) and/or CellCountingKit-8 (CCK-8 ...
-
bioRxiv - Cell Biology 2021Quote: ... using a CellTiter 96 AQueous One Solution Cell Proliferation Assay kit (Promega, USA). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... The luciferase activities were measured utilizing the luciferase reporter assay system kit (Promega).
-
bioRxiv - Cell Biology 2020Quote: ... the CellTiter 96® AQueous One Solution Cell Proliferation Assay kit (Promega, USA) was used following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2021Quote: ... luciferase activity was measured using a Dual-Luciferase Reporter Assay kit (Promega; E1910) with a 20/20 Luminometer (Turner Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... All cell lines have been DNA fingerprinted using the PowerPlex 1.2 kit (Promega) and were found to be mycoplasma free using the e-Myco kit (Boca Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... and luciferase assay performed using a dual luciferase chemiluminescence detection kit (Promega #E1910) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Levels of accumulated cAMP were detected with the cAMP-Glo™ kit (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... activity of both reporters was measured using the Dual-Luciferase Reporter kit (Promega) and read on a Tecan Infinite 200 PRO Reader ...
-
bioRxiv - Immunology 2022Quote: RNA was first reverse-transcribed to cDNA using GoScript Reverse Transcriptase kit (Promega) following the manufacturers protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... and the first second PCR kits were obtained from Promega (M7122, Madison, USA).
-
bioRxiv - Molecular Biology 2022Quote: ... and firefly luciferase activity was assayed using the Dual Reporter Luciferase kit (Promega).
-
bioRxiv - Synthetic Biology 2022Quote: ... Luciferase assay was performed using the Dual Luciferase Reporter Assay System kit (Promega). Bioluminescence was measured using CLARIOstar (BMG LABTech).
-
bioRxiv - Pathology 2022Quote: ... LDH activity in the supernatants was measured using CytoTox 96 kit (Promega, G1780) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted following the Maxwell 16 LEV Tissue RNA Kit protocol (Promega). For tissue-specific assays ...
-
bioRxiv - Biochemistry 2022Quote: ... using the Wizard® Genomic DNA Purification kit (Promega, Charbonnières-Les-Bains, France). The final pellet was resuspended in 40 μL of sterile ultra-high quality (UHQ ...
-
bioRxiv - Biochemistry 2022Quote: ... NFAT-luciferase activity was determined using Dual Luciferase Reporter Assay Kit (Promega E1910).
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA was robotically extracted using the Maxwell tissue RNA extraction kit (Promega) and quantified using the Nanodrop ND-1000 UV-Vis Spectrophotometer (Nanodrop technologies ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was extracted using the Wizard Genomic DNA Purification kit (Promega, A1120) following the manufacturers’ guidelines and quantified using the Nanodrop 2000 Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: Measurement of CYP3A4 enzymatic activity was performed using the P450 Glo kit (Promega). Cells were incubate with 1:1000 luciferin-IPA in Hepatozyme complete for 1h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was isolated using the Wizard® Genomic DNA Purification kit (Promega). Cells were resuspended in 100 μl of 50mM EDTA with 500U PlyC and incubated at 37 °C with shaking for 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA isolation was performed using a Wizard Genomic DNA purification kit (Promega). Plasmid isolation was performed with GenElute plasmid miniprep kit (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: Intracellular adenosine triphosphate (ATP) levels were measured using a BacTiter-Glo kit (Promega) according to the manufacturer’s instructions ...