Labshake search
Citations for Promega :
1351 - 1400 of 1454 citations for 7 Oxa 12 thia spiro 5.6 dodecan 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cells were passaged every 3–4 days and regularly checked for mycoplasma infections using a GoTaq G2 Hot Start Taq Polymerase kit from Promega.
-
bioRxiv - Molecular Biology 2023Quote: ... All transfections were done in triplicate and luciferase activity measured after 3 days using the Dual Luciferase Reporter Assay System (Promega).
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... total RNA was purified from 3-4 tissues of female flies using a ReliaPrep RNA Tissue Miniprep kit (Promega, z6112). Quantitative RT-PCR was performed using a OneTaq RT‒PCR kit (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Biochemistry 2023Quote: ... using 3 µl of the in vitro translation reaction mixture in 150 µl of luciferase assay reagent (Promega, Fitchburg, WI). The graphs in Fig ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Molecular Biology 2023Quote: ... or PCR amplified from the genome (Tom-3’UTR, primers are in Table S1) and cloned into the psiCHECK-2 vector (Promega) linearized with XhoI and NotI restriction enzymes ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Immunology 2023Quote: ... Select colonies were then grown in 3 ml of LB with appropriate antibiotics and the plasmids were purified with PureYield Plasmid Miniprep System (Promega), performing restriction enzyme digests to verify that the plasmids had inserts.
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... The transfected neurons were stimulated with 200μM glycine for 3 min and then washed for 30 minutes before lysis in 100 μl of buffer for dual luciferase assay (Promega). 20 μl of the lysates were used for the quantification of Firefly and Renilla Luciferase activity using a Luminometer (GloMax ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were cultured for 3 days and cell viability was measured using CellTiter-Glo® 3D Cell viability assay (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR was performed for the splicing analysis with the 3 µl of cDNA in a total volume of 20 µl with GoTaq Polymerase 2X (Promega) and 32 amplification cycles ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Cell Biology 2023Quote: Protein-protein interactions between Mkl1/2 and Foxo1/3/4 or glucocorticoid receptors were also measured using NanoBiT PPI Starter Systems (Promega). 293FT cells were seeded in 96-well white wall microplates and co-transfected with the LgBiT and SmBiT plasmids ...
-
bioRxiv - Neuroscience 2023Quote: Wild-type and mutant Shank2 and Mdga1 3′ UTR luciferase constructs were generated by standard cloning procedures into pmiRGLO dual-luciferase expression vector (Promega). First ...
-
bioRxiv - Cell Biology 2023Quote: The Human SART1 mutant resistant to siSART1#3 and its deletions mutants (amplified by PCR) were subcloned into pCI-neo Mammalian Expression Vector (Promega).
-
bioRxiv - Cell Biology 2023Quote: ... was added to 3 of the wells per treatment condition and 50 µL Oxidized Glutathione Lysis Reagent (Promega Cat #TM344) was added to the other 3 wells per treatment condition ...
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Cell Biology 2023Quote: ... Intracellular fluorescence was monitored after 2 and 3 h of nanoalgosome incubation by spectrofluorimetric analysis using a microplate reader (Glomax, Promega). As vehicle-control ...
-
bioRxiv - Molecular Biology 2024Quote: ... PAT-PCR was performed using a 3′ UTR-specific forward primer and a PAT universal primer with GoTaq Green Master Mix (Promega). The PCR products were separated by 6% PAGE in 0.5× TBE ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The PC-3 cell line was authenticated by Macrogen (Korea) using short tandem repeat (STR) profiling (Powerplex 21 System, Promega). All cell lines tested negative for mycoplasma contamination using the Microsart AMP Mycoplasma Kit (Sartorius).
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was extracted from lymphoma derived cell lines as described above and PCR amplified using sgRNA specific primers (Supplementary Table 3, p53 primers as previously described (13) and GoTaq Green Master Mix (Promega). PCR products were amplified a second time using indexing primers ...
-
bioRxiv - Cancer Biology 2021Quote: MAGI2-AS3 or FOXN3 3’UTR containing miR-452-5p wild-type (WT) or mutant (MUT) binding sites were inserted into psiCHECK vector (Promega, USA). 293T cells were transfected with the constructed luciferase plasmid together with miR-NC or miR-452-5p mimics using Lipofectamine 2000 ...
-
bioRxiv - Microbiology 2019Quote: ... using FuGENE6 transfection reagent at a ratio of 3:1 (FuGENE6:DNA) according to manufacturer’s instructions (Promega, Madison, WI, Cat. #E2691). Twenty-four hours post-transfection ...
-
bioRxiv - Molecular Biology 2019Quote: ... the cells were transfected with 700 ng of plasmid construct (PIB/V5_Gr9) and 3 μl of FuGENE® HD transfection reagent (Promega, USA) in 100 μl of medium per well ...
-
bioRxiv - Cancer Biology 2020Quote: CellTiter 96 AQueous One Solution Cell Proliferation Assay MTS 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) was used according to the manufacturer’s protocol (Promega, Madison, WI) to assess proliferation of cells cultured in 96-well plates.
-
bioRxiv - Immunology 2021Quote: ... 2.5 μl TDE1 and 22 μl nuclease-free water were combined and placed at 37°C for 3 min before 0.5 μl of 1% Digitonin (Promega, Cat. #G9441) was added to the master mix ...
-
bioRxiv - Cell Biology 2020Quote: ... at 3500 cells/well and cell proliferation over 3-5 day periods was determined by measuring luminescence with CellTiter-Glo® assay kit (G7570, Promega), according to manufacturer’s instructions ...
-
bioRxiv - Zoology 2021Quote: ... cDNA (DFV, NDV, AIV, DHV-1, DHV-3) were prepared with viral RNAs using M-MLV Reverse Transcriptase (Promega, Wisconsin, USA). Bacterial genomic DNA (R ...
-
bioRxiv - Microbiology 2020Quote: ... This was followed by a second round of TBST washes before incubation with HRP conjugated goat anti-mouse Ab (1:5000 Ab in 3 % BSA in TBST; Promega Corp.) for an hour ...
-
bioRxiv - Physiology 2022Quote: A DNA fragment corresponding to partial f5 or f3a cDNAs was amplified from ovarian cDNAs by PCR using the gene-specific primers (see Supplemental Table 3 for detail) (28) and cloned into the pGEM-T Easy vector (Promega, USA). Correct sequence and orientations of inserts were validated by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein was digested with Lys-C (Wako) (1:50 enzyme-to-substrate ratio) for 3 h at 25°C and with sequencing-grade modified trypsin (Promega, V5117) at 25°C for 14 h ...
-
bioRxiv - Biochemistry 2022Quote: The crRNA (5’-AAUUUCUACUGUUGUAGAUGUGAUAAGUGGAAUGCCAUGUGGG-3’) was synthesized and purified using the T7 RiboMAX™ Express Large Scale RNA Production System (Promega). The following DNA templates were used for the in vitro transcription reaction ...
-
bioRxiv - Microbiology 2021Quote: ... Remaining ATP was readout after 3 h incubation using Kinase-Glo® Luminescent Kinase kit following manufacturer’s instructions (Promega, WI, USA).
-
bioRxiv - Immunology 2022Quote: ... Samples were diluted two-fold with 100 mM of triethylammonium bicarbonate (TEAB) and proteins were digested during 3 hours with 1 µg of trypsin (Promega V5111) and 1 µg of LysC (Wako 129-02541 ...
-
bioRxiv - Cancer Biology 2022Quote: ... These cells were transfected with the pcDNA6.2-GW /EmGFPmiR plasmids containing miR sequences (miR-NRF2 #1, #2, #3, #4 and miR-ctl 79 using the FUGENE HD transfection reagent (Promega #E2311). Seven days later GFP positive cells were isolated by flow cytometry (Biorad S3e cell sorter) ...
-
bioRxiv - Cell Biology 2021Quote: ... of miR-148a putative binding sites reporter plasmids were constructed using the circMRPS35 and 3’-UTR of STX3 sequences in the psiCHECK2 vector (Promega, USA). For IRES activity analysis ...
-
bioRxiv - Cell Biology 2020Quote: Transfections were carried out with 1 μg of total DNA (500 ng for each construct or with empty expression plasmid) and 3 μl of FuGENE ® HD Transfection Reagent (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... supernatant was harvested from Calu-3 cells and inactivated by addition of lysis buffer (Maxwell 16 viral total nucleic acid purification kit, Promega #AS1150) complemented with proteinase K ...
-
bioRxiv - Microbiology 2021Quote: The cell viability of Vero E6 and Calu-3 cells was analyzed by quantification of ATP levels using the CellTiter-Glo™ Luminescent Cell Viability assay (Promega) according to the instructions of the manufacturer ...
-
bioRxiv - Developmental Biology 2020Quote: ... with an added 5’-CACC-3’ at 5’-end and 5’-AAAC-3’ at 5’-end of the complementary strand were annealed in 10xT4 ligation buffer (Promega M1801) by continuous cooling from 95°C to 25°C ...
-
bioRxiv - Plant Biology 2022Quote: ... the coding sequence of RE02 extended by BsaI cleavage sites (Supplementary Table 3) was cloned into the pGEM®-T vector (Promega). The cauliflower mosaic virus 35 promoter ...