Labshake search
Citations for Promega :
1351 - 1400 of 4451 citations for 6 Fluoro 2 hydrazino 1 3 benzothiazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... Homozygous lpat2-3 T-DNA insertional mutants were identified by PCR using Promega PCR Master Mix (Promega) and combinations of the gene specific and T-DNA left border primers pairs ...
-
bioRxiv - Cancer Biology 2020Quote: ... The 3’UTR fragments were cloned in the XbaI site of the pRL-CMV vector (Promega, #E2261) (pCMV-Luc-PTCH1 3’UTR wt/mut) ...
-
bioRxiv - Plant Biology 2020Quote: ... using 3 - 5 μg of total RNA and 250 ng of a mixture of random hexanucleotides (Promega) and incubated for 50 min at 50°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... The experiment was continued for 3 days and then the cells were treated with CellTiter-Blue (Promega) and incubated for 1 hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were then incubated for 3 days and viability was assessed using CellTiter- Glo assay (Promega, G7572) following manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... The cell pellet (on ice) was resuspended in 3 ml Red Blood Cell Lysis Solution (Promega, Z3141) for 4 min and span down for 5 min at 300g in a pre-cooled centrifuge.
-
bioRxiv - Microbiology 2020Quote: ... membranes were incubated in a 0.165 mg/ml BCIP (5-bromo-4-chloro-3-indolyl phosphate, Promega)/ 0.33 mg/ml NBT (p-nitroblue tetrazolium chloride ...
-
bioRxiv - Cancer Biology 2021Quote: ... samples were adjusted to 3 mM EDTA and digested with 0.5 μg Trypsin/LysC mix (Promega #V5073) for 1h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... and then lung lobes were inflated with 3% (w/v) 45°C prewarmed low-melting agarose (Promega). The inflated lung lobes were immediately removed and cooled on ice for 15 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were subjected to Caspase 3/7 activity measurement with Caspase-Glo assay kit (Promega, Madison USA). Briefly ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’UTR-Nogo-A-wt product was subcloned into both the pGEM-T-easy plasmid (Promega) and the pBKS plasmid (pBluescript ...
-
bioRxiv - Molecular Biology 2022Quote: ... the HIV 5’ LTR from the pNL4-3 isolate (Genbank AF324493) was cloned into pGL3-Basic (Promega) via Gibson assembly (NEB 2X HiFi ...
-
bioRxiv - Immunology 2019Quote: Cell viability and caspase 3/7 activity were measured using Non-Radioactive Cell Proliferation Assay kit (Promega) and Caspase-Glo® 3/7 assay kit (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nuclear pellets obtained after centrifugation at 1,500g for 3 min were lysed in Reporter lysis buffer (Promega), passed through a 21Gneedle and incubated on ice for 10 min before centrifugation at 17,000g ...
-
bioRxiv - Genetics 2020Quote: ... for 3 hours at 37°C in the presence of RNasin Ribonuclease Inhibitor (Promega #N2111, Madison, WI), and PE2 mRNA was purified with MEGAclear™ Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2019Quote: Genomic DNA extracted from 3 ml fresh EDTA-blood (wizardR Genomic DNA purification Kit, Promega, Madison, WI) was used for genotyping ...
-
bioRxiv - Developmental Biology 2019Quote: ... plus the full-length 3□UTR of KIF18A in the psiCheck2 dual luciferase vector system (Promega, Germany) in 10:1 (plasmid DNA:luciferase vector ...
-
bioRxiv - Cell Biology 2020Quote: ... bound proteins were alkylated and digested with endopeptidase Lys-C (Wako) for 3 hours and trypsin (Promega) on beads overnight at 37°C.
-
bioRxiv - Cancer Biology 2021Quote: ... cell viability and Caspase activity were detected with CellTiter-Glo 2.0 and CaspaseGlo-3/7 assay (Promega) respectively 2 days after transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... the full length of wnt4 including 3’-UTR was cloned into pGEM-T easy vector (Promega, A1360) by primers 5’-ATGTCATCGGAGTATTTGATAAGG-3’ and 5’-AGTCTTTGACACAGCATATATTTC-3’ from cDNA ...
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... Relative cell growth at day 3 was evaluated by CellTiter-Glo Luminescent Cell Viability Assay (Promega, #G7571). The concentration of inhibitor required for 50% inhibition of cell viability (IC50 ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were first transfected with 3′UTR luciferase constructs (10 ng) using FuGENE HD transfection reagent (Promega) for 4 hours then transfected with Dharmacon miR-199a-5p mimic (50 nM ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were adjusted to 3 mM EDTA and digested with 0.5 μg Trypsin/LysC mix (Promega #V5073) for 1h at 37°C ...
-
bioRxiv - Immunology 2023Quote: Proteasome activity was measured in cell lysates using the Proteasome-Glo™ 3 Substrate System (Promega, G8531). Corresponding reagents for testing as chymotrypsin-like ...
-
bioRxiv - Immunology 2023Quote: ... VP1-3 proteins were then bound to the S-Trap column and digested with trypsin (Promega Corporation) for 2 hrs at 47°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were adjusted to 3 mM EDTA and digested with 1.0 μg Trypsin/LysC mix (Promega #V5073) for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... caspase activity in cells was measured using the commercially available Caspase-Glo 3/7 Assay (#G8090, Promega). Ultra-low attachment counts were normalized to the attached plate measured 16 h after seeding.
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were adjusted to 3 mM EDTA and digested with 1.0 µg Trypsin/LysC mix (Promega #V5073) for 1 h at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were adjusted to 3 mM EDTA and digested with 0.5 µg Trypsin/LysC mix (Promega #V5073) for 1h at 37 °C ...
-
bioRxiv - Plant Biology 2020Quote: ... approximately 0.6 mg IgG-enriched proteins were first digested on the beads with mass spectrometry-grade Trypsin/Lys- C Mix (Promega, Madison, WI, USA) at a 1:50 (enzyme/substrate ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 µg retroviral vectors were independently introduced into Plat-GP cells using 2.25 µL of FuGENE 6 transfection reagent (Promega, Madison, WI, United States). In addition ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK-293 cells cultured in DME/F-12 with 10% fetal bovine serum were transfected with either of these constructs using FuGENE 6 Transfection Reagent (#E2691) from Promega (Madison, WI, USA). Approximately 72 hours after transfection ...
-
bioRxiv - Immunology 2021Quote: ... Pseudovirions were produced in HEK 293T/17 cells (ATCC cat. no. CRL-11268, Manassas, VA, USA) by transfection using Fugene 6 (catalog number E2692, Promega, Madison, WI, USA) and a combination of spike plasmid ...
-
bioRxiv - Neuroscience 2020Quote: ... COS-7 cells were transiently transfected with 2μg plasmid (MuSK-HA, or GFP-Vangl2 alone, or in combination) using Fugene® 6 reagent (Promega, catalog no. E2311), according to the manufacturer’s recommendations ...
-
bioRxiv - Physiology 2023Quote: Glutathione content was measured under normoxic conditions and after exposure to 30 min and 6 h hypoxia using the GSH-Glo Assay Kit (Promega, Madison, WI, USA) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Three μL (6 ng on average) of template DNA was added to 5 μL 5x GoTaq Green Reaction Mix Buffer (Promega, Madison, Wisconsin, USA), 0.625 units of GoTaq DNA Polymerase (Promega ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Genomics 2020Quote: ... 50000 viable cells were pelleted and lysed in Resuspension buffer (Tris-HCl pH 7.4 10 mM, NaCl 10 mM, MgCl2 3 mM, NP40 0.1%, Tween-20 0.1%, digitonin 0.01% - Promega #G9441) for 3 min on ice ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Cancer Biology 2024Quote: ... Spheroids were treated as indicated for 3 days and viability was measured using 3D CellTiter-Glo (#G9682, Promega) and a GloMax luminometer (Promega).